Description :
From Genome Similarity Track
Location :
Scaffold_8:7496- 9863
Sequence
2367 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAATCTATCAAT
TGATCGCCATCCCATGCATCACAAAAACGATTGCTAATTAAGTTAAACTATCACGAAAATATTATTATCAATTTCTGATTAGAACAAGAAGTTGTGATCA
TCGCTAGTTGCTCTACTTACTGTCTTTGTTTACTCCGCTTGCGCTTCGATTTTGGTTTGATTTCAGTCTCCGCTTTCCCTTTTCACACGGCTGGTTACCG
AATGACATAGCAGCATTCGCAACTGGAGAGGAGTTGCACAATGGCAGTAGGATGTTACCCATATGAACAGGTTGGAGGTGACCCGGGTCACCATAACGGC
CCGGGCGTTGCAAAACCTATGATGTTACATATTCGTTTGGTTAGTAGACTTCAAAGTCGAGCCAAAATAGAAGGTCGCATAGAAGCGTTTTGAATGCTCT
CAACTGCTTCAGAGTTGAAAAGTGAAGCTTATAATAATGCTAATTGTGCTACTTTGACTTGTTGTGCTGTTTTGACTTGGGCGAGTCACCGTGGGCAGGC
AAACAATCACCACTCAAAAAAATAATTAAGTCGAAATCTGGACTCGAAACATCCAGACTAATTGCGCACCCAGACTATTTGCGAACGAATACAAATAACA
AGATAAACCTTAAATGGGTCACAATTTGGACTTATTTATAGTACATTTCCAAGAACTGTAGTGTTCTTCGAAAATGAGAAGAGCTCAACTTTACCAATGT
TTTAGCCTAATAGTTGTCCTGTAAGGACACCGAATTACTACATAAAACTGATTCAGTTTTGGTACAATATTCGGTCTTGGTACAACATTAGGCCTTGGTA
CAACATTCGGCTTTTAAAAGAAGATTCCGTTGGGCATAATGGAGAATGAATCTATTCCCGCCCGAATGCGGCGGATATCCTGGAACCAAGTGACGTGCAA
TTTCTGTGGTGTGCGTGTCCGTTGCGAAGCGCGACGAGTGTCCGGGACAAGGCGACAAGTGTCCACCAGCGTTGTGCGTACTGGGTTGCGTGCGTTAAGC
TAGAATAGACTGGCTTTTCATCGTGAAAAAAACTTGCAAATTCTTGCAAAATTAGATGGGTGCTCTATTGGTTTTTCCTCGACGCTTTAGTACGCTGGTT
AAGGCGTGTTCGTTCTTCGTGAGGATAAGTAGATTCTAATACTGTTTGCTTTCTTACCAGCTGCAGCGATGTTAGCTCCCTCTCTCTCTATGTATATATA
TACATGTATATATTGCGTTTGTGCGTAAGTACGATCTTGCGTCATTACGAGGTACTAGTCAGAATCATTGAAAATGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN