Description :
From Genome Similarity Track
Location :
Scaffold_25:749590- 750613
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11927hypothetical protein

Sequence
1023 bases(100 bases per row)
CACCGCTTCAAGGCCGCATACGAAGAGATGAATGACCCGCACTCTGTTCTCCAGCAATGGCTTACAACGGCCAATGTGGATCGCACTCCGAAGTTGGTGC
TACCGTCTGTGTTAAGGAGAGATCTTCACACGATGCACTCGACCATTTCGGTCTTCTCTTCGGGCGCTAATCGCACGCGGTATCTCCGCTCGCTGCCTCG
ACCGTACGTTAAATTCTACTCGGAGCTGGCGAAGCGCAAATGCCAATCGTGTCACCAGTTCCCTGCCCGGCCTGCTGTCTGCTTGCTGTGTGGAATGCTG
CTCTGCGCCGCCAATACATGTCCGTCGATCCACTTGGACAAAGGTGGATACCCGGACGAGGCCAATCCCGGTGCGTGTACCGTTCATGCCAAGAAGTGTG
GGCGAGGCAGCGGTATGTTCTTGTTAGTACTGGAAGGTGCCGTGCTGCTTGTGTACTGGAAGCTGGCAGCGTATGTGGGGAGTCTCTACGTGGACGAGTA
TGGAGAGGAGTTCGGCGAACGCAACCGCGAACTGAGCAAGGGCCGTCCACTTTACCTCAACGAGGAGCGACGTGAACGGCTTCTGCGACTGTGGCTGCGT
CACGAGATCCCCAACGAGGTCGTCAAGATCCAGAACAGCTCCGAACGTGTCATCCGCAACAGCCACTACTGATCGATGTAAAAGCAAGAGAAATTCCACG
CCCTACCGCTGGCAGTGTCAATAGCGAGCTCGGCCACTGCGTAGACACTGGTCGAGCGTCAACCAATAAACAATAAACGAGGCAACTGAACTTTGAATTA
AAGTCTGAAGCAGTGCGTCACAGTAGACGGAGCACTATGACACCGGACACGTGTTTATTGTGATTGGCCAAATATGCTATTTGAACTTCAACCGATCGCA
CTTTTTGTGCAATATTTGTTTTGATTGGTCGAAAGTTCTGTTTAACGCTGATTTTGGAAAAAAAATCGTAAAAATCGTCCAAATTCGTACTTAGTGAAAC
GAGCGGTGGAGATCCTGAGCTCC