Description :
From Genome Similarity Track
Location :
scaffold_179:7495- 9404
Transcript NameFunction/comments
g5187.t1 hypothetical protein PHYSODRAFT_349597
g5188.t1 glutamyl-tRNA synthetase, putative

Sequence
1909 bases(100 bases per row)
CATCTGGAGGCACAGGGATCACGATCTCCACGTTGTTCGCGATGCTGCGGCTCTTGAACTGCGACTTGGCCTTGACCATGTACTCGATACGCGAGCGCGA
GTGGGGCTCCACCACTGCTTCGACCCAGATCAACGGCTTAACGTGCGTCGCCAGTCGGTACGTCATGAGGTCGAACTCTCCATCAGGCGGGATGAACGAG
ATCGTACGATCCGACTCGAAGCGCGCGAGCCGCACACACTGGTGGAACTTGATGTCCTCCATCTCGACAGCTTTTCCCTTGCTGGACGAGCGCCCTGTGG
CTTCGAACAGCGCCTTGTCGTTAAGGCCGAGCTTCAACTCGGGCATACCGGACAGGAAACTTTTCATCTTGACAGCTCCGATAATCTCCGAGTGGAGTAC
CGTGCCGTTACTGGAGACCAGCAGGTTGAGCTTCTCCACGACGTCCAGGAAGATCTCGTTCTTGCGGTGCTTGATACCTTCACTACGCCATGAAACGGCA
TTGGTAAGAGCTGTAGGAGGGCGTGGAGCAGCCTCCAGTCTGTGGCCTTCCTGGGTGATGTACTCCCGTAAGATGCGAGCCTCCGTGGTCTGCGGGTATC
CGTGGTCCATCGTTTCATCCAATAGCTCGAAGATGATGACGAAATTGTCTCGAATACTCTCCTCCTCCAGCTCACCGAAGTAGTCCCGGAAGACTTGGCA
GATGCGGGTGAGGTACATGAGCATGAGCGCCACGTTGGAGTTCACCTTGGTTACGGTCATGAGATACAGGTTATTATGCTGTATTTCACACACAGATCAG
TGAGTAAGTGTTGTATACATATACAGGATAAGAAGTATACATACTTTGAGGTAGACAAACGTGTAGCCGTCCTCAGTGAACACGGGGCGCTGTTCCGAGT
CGTCCTTATCCTGTACGTAGCGCGTGAACTTGGCCGAGGCGGACATGGGGATGTCCCCGCGGTAGTTGCGCGAGATGATGACCTTGCCCTTCAGGTCGGT
GATGAACACGGCCGACAGCACCATCGTGACGGAGAGAGGTTCCTTCCTAGTGCTTACGTCCGGCGCTGATAAAGGAGTGCCGCGTGGTATCTATCCAGCT
GGCTCATGTGATTGGCTAATATTCAGGAATGCCATAAAGTAGTATACCGGTGCATACCGTCGTTTAGAAAACTCGTGTGGACACAAACCGGGTACATACC
GGTGCGGTACGCTCTCATTTTGGAACAGTTACCTCTGCGAAAAATCGCGTACCTTTTTTCTGGTACGATTGCTTGGTGAATACCGGTACGCTCCCAAGCC
AATCCAAACAGCCCCAAGATCGCTTTCATTCGTGGTTCTGCAGTCTCAAGCACAAGAGAAAAAGAGTGACCATCACTCTCGATCGTTATGGCTACAGAGG
CGGAATTGACTGCGCAGATCGCTGCTGCAGGCGAGAAGGTGCGTGACCTGAAGGCGCTGAAGGACGCCACCAAGGCTGACGAGATCAAGGAGGCCGTGGC
GCAGCTATTGGTGCTGAAGACCCAGTTCAAGGAGGTCACGGGAAAGGACTTCGGCCCTCCGCCCAAGGCCAAGAAGGAGAAGAAACCGCAGGCCGAGCAG
CCCAAGGACCCGTCCAAGAAGTCCAAGAAGGAACTCAACAAAGAGCGCAAGAAGGCGCACAAACACGCGCTCAAAGCCGGCGAGGAGGCTCCGGCCCCCA
CTTCCGTCGCACCGGTACCTGCTGCAGCCCCCACTTCTGGCAAATCGTCGCTGAAGAAGGCGGCGCACGCCGGTATTGAGCTGCCTGTGCCCTCGGCTGA
GAATGACGGCGTCATCGTCTTCTCCAGTGCTGGTCAGCTGCCGCGTGCCAGTTACGTGGTCGCCCAGCTCGTTAAGTACGCTCCTGGCTTCCAGAACTTC
GGTCGTGAT