Description :
From Genome Similarity Track
Location :
contig_75:74935- 76666
Transcript NameFunction/comments
g12334.t1hypothetical protein

Sequence
1731 bases(100 bases per row)
CGGCGACAGCACACAGCCTCCTCCGTATTCTGCTTCTCCTCCAGACGCCGGCGACGTCGAGAAGCGCCCCCCAGAAGACTCAAGCCAGCCTTCAAGCGGC
GAGTCTCAGGCCATCATCCTGCGTCAGCCTGATGGTGACGACAGCGCCGAGAACGCCCCAGATACGAGCGAAAATGCTGGTGGCAGTGGCGTCAGCCCCA
TCCGATGGGCGAGGGTGTCGTGTTGCCTTCCTTCTCGCGACCACGCCACGTGCGGATGGAAGACGTCGACGCGCTATTTTCAAGGGCGTCCTATCGCAAA
ACGATTCGTCCCGAGACTTTTGCTCCTCCTGACTCTTCGGCGCGCTGGACCTTGCCTTCCCTCCAGACACCGGCACCAAGACATACTTGGTGGGTTCCAG
CCACGGTGGACGACACGCGCGGCGGCGGCTTCACGATGAATGGATATGGGGGCACTACAGCATTGATTGGCTTCGAAGAGATGAACGCGGACGACAATTC
TGAATTCGAGCGTCTGTTTGACATGAATGCCCGTCAGTACCTCCTGCAAGCGCGACAAGATCCGCTCCGGCTGGATGCCTTGACCTCCAGTCTGGACGAC
ATTGGCACGCGACGTGAATTCGCCTCGATCCTGACTCACTTTCCTCCGGATCAACTCGCCTCGCGTGTCTTCCGCACTTCGATGTATTTGCGTCTTGTTC
TGGGTGAACATCGTCGACTTCGGGCGCAGATTGAGCGTGGTCAGGAAGCCGCGATTAAAGACGCTCTGGAGTTCAAGCGCATCAATGGTGACCTTCGTCG
TGAATGGAAGTTCGTCTGCGCACACTGGCACCAAGAGGTGACTTCTGCACTTGCCAAGGCCAACGAAATCAAGGCCTCTGACCAAGACGAAGTCCAGGCG
TTGAAGTCTCGATACCAAGACCAAATCGACGCGCTTGAGGCTGAGAAGTCCGAGTTGAAGGCCCGTGTCGACGACGCAGAGACTCAAGTTGGCATCCTGA
AGAAGCGTCTGGACGATAGTACCATGGATCCTTGGACGCTGTCCGCCTTCATGCAGAAGCACGCTGACGTCTCCGGCAACTGGGATCGGCTGCATGACTT
GTTTGTGCACTGCGTGAATGGCTGCGTTCCTCCGTCTGCTTGGGACACCGTCGTCAACATCACGGCTATGGATCAACGCAAGGCTCCAATTCCAACGTTT
CCTGCGTCTCGTCTGGCTGTTCCAGTTCCCAAGCCTCCGGTTTCGAATCCTGTCATTCTGGACTTAACCAGTCCATCTGGCATTCAGGAGTCCAAGCCGC
ATTCTGGTGACAAGTCTTCGCAGAAGTCGCCTACTCCAAAGTCACTCAAGAAGACCAAGTCTCCCAAAGTCCAGAGGCGACCATCGACTCATCACCCAGG
CCGCGACTCAGTGCGCAAGGCCGGTGAGAAGACCACCATTTCCAAGGAGGCTGCATGCAAGATGCTTCCTGGGCGTGTCATCTGGAAAGAAGTGCGTCCT
GACGTCCGGCAGATTATCCTGGCTGGAATCAAGTATGAAACGGCAATGAGGCGTCTTGACCAAGACAAGCCGGCACACGGGTTCTTTCGGCAACCGCAAC
TGGTCAAGATGTTGGTCAGCATGATGTACTGGCGTCGTCTTGATTTGACCCCATGGGCCAGGTATGTGCCAACGACGTATTACAAGATGGCAGATGAGCG
CCTGGATCGCAAGCTGCGCCGCGGGGAAGTG