Description :
From Genome Similarity Track
Location :
Scaffold_71:7492- 9810
Sequence
2318 bases(100 bases per row)
GTGTTACAGACCTAGTTCTTCCCCAGTAGGGCGCCCCGCGCCTACTGGGTGTCGGCATTTCCCCGTGCCATGCCAGACTTCTGGCTCGGGGTAGAGTGTT
GACTCGTAGCCTGGCGCTGTTTACGCAAAGGGCAACCAGGCCGTAAGTGTTTAGTGCTTCCGCACGTATAACACCTTCGTACAACACGTTGCTGCTCAGC
AGCTTAAGGTTCAACTTCACCTTCATCTTCAGCATAGCTGAGATCCATCGGTTCTGGTCTATTAACGGCCGGAGTACTCGTGCAGTTTGCTCTCGCAGAG
CTAGGGTTGTACCCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCATTAAGAGCAATTCTCACAGCCTCTTCGAATGTAGAGGGATGAACCC
GAAAGACTTCGGTTCTGGAAATGCCAGTACGGAGACCCTCCATGAATATAGTCACATGGACTGCCTCAGGCAGAGGGTCAGACTGCATAGCAGCCATGAG
AGTTCTCAGCTCTTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGGTTGATAAAAAGCGTGAAAGCACGCGGTAAGCCTGGTTAGGTTTTGAAAAC
ACCTGTATTAATTGTGACTTAAGCGACTCCCTTGTGGAAAACGCTAAGTCGACCGACGTGCTACATGTCAAAGCCCATTCTCTAGCTCTTCCATAGAGCT
TTGAGATAGCCAGCGAGACCTGTTTATGGTCAAGCTTGATCAGGCCTGATCTCATGGCCATCTCAATCTCACGGATCCAGAGGATGAGGTTTTCACCCTC
CTTTCCTGAGTAGTTTTTAGCTTCCACTTAAGTGGACGAGGCCTAGACTCTTCATCTGGAACAGACACATAGCGTGTAGGCATAGCCGACGACATTTGGT
CTTGGACCTGCCCTAGAAGGGACTCTTCATACTGCAGGAAGCCCTCAACACGTGCAGTCAGCACCTCCGGGCCTTGCGATACAAGGAATTCCACATACTC
TGGACCCAAAGATGCGGTCAGCTTATCAAGCGCGACCTTTGGGGCCTCAGAGAGGGGAGTGGGGTTTTCCATCCTCACAGAGGATACGTCTTTAAAGACT
CAGGCGTAGATTGACTACAAGTGCTACCAAGTGAAGCGGGGCGACAGAGCTCCTTAAGTCAGAGGAAGACTTAGTGCTCAAAGAGCGATATTAGTTCTAA
AGAACTAAACTCTATGAGTCAACAAGCGCAAAGCTTAAGGTCTTTGTCCCAGATGATCGAACAATTCAGTGAATCTATAGCACTTAGTGCTCAAGAGTAG
CTACCTCAGATAGATGTTGCCAGCTCTTAACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAGGGGAACTGAACTTTATT
TACGTTTAACTCTACAGAATATCTTAATCTTAATATTACATAATCTAGGACCTCATGTCCTAAATTAATATTGATCTTTCCTATCTCGTGGCTAACACCC
GTCGGCCCCTATAAACCGATAAGATATTCTATATCTCTTTGAGTGGGATGCCATCCCGTGTGTATAAGGCACAGGGTACCGAGTATCCTTCGATGTGTAA
CCTTTTAAAGGAGAAGAAGTCATATATGTCCCGACGGAGATGGGTTTTCGAATTTGGACTTACTGACGGATCCGACCATGATCACCATGACAGACGGCAG
CGAAGTGGAAGCGCAAGGTGTTAAGACAGTGCGCGTGCAACTCAAGACTGGTGAAGTGACCAGGACGCTATAGGTGTGTCGCCTAGACCGAAGGCAGTAT
CGGCTCAAGTACCAAGACAAAACAAGATGTACGTCTTAGAGTGCAGCAGTCCGGCTGAGGTAGCCAACATATGCGAAGAGACGAATCATAAGTAAAAGTC
AAGTGACGGATCAGGAGTGGCTGATCACAGGTGTGGTATGCAAGATTAGGTTACCTACCAATGAAGATGCTTAAGGATATGGCAAGTTGCTTCAATGGAA
TGAAGATCAAGGAGAATCAAGGCGGTGCATATGACACCGAGATCAGAGAAGGGTGCATCATGGGCAAAGCTACCGTCAAGGCATTTCCTAAATCACCTTA
CGGACAGGTGAAAACCATGGAAGTGTTGGAGTTGGTCCACAGTGATTTCATGGGACCTATGGAAACGAAGTCTCGAGGAGGATCAAGATTTGTCGTGACA
TTTATGCGATGACTTTTCGAGAGATATAGCCGCATACTATAACGAAAACAAGTCGGAAGTGACGGATCGCTTCATCGAGTACACGGCACTTATGGAGAAT
CAAATTTTCAAGAAGATC