Description :
From Genome Similarity Track
Location :
Scaffold_1222:749- 3874
Sequence
3125 bases(100 bases per row)
CTGATTGAAATCTCAGTCTTTCTGGTGATCCCCGAAGTCCGTGTAATTCACTAATGACCTCCGAGAAAATGTTGGCGCTTCCTGACTCCACCATACCCCG
CGATCGTTGAATTCCGGATTATGGTGATCGGGTTCCGCGATCAGCGGTAGACGTGACCCCTGGTCCACTCGAAGAGTCAGCCTGATCAGCGTGTCGGAAC
TGGACTTAGACCTGTTCTATCACCACTTCTCGAAGCCCAAGGGATACATATTCCCTGTCCAGCAGGGTAATCTTCGCACTCCTCCGAAATTTTCTTGGTC
ATCCCAGCTGATCACGTCCACCAAGATCAACCAGTTCTACGATCAGCAACCGTGGGACGTGTACGATCAGATCGTACGTCCGATCTCGTTCAAGCCTTCC
GGATGGTTTGAAATCTGGTCGAGGCGTATGAAGCTTTCGTGGATTGTCATCGTCAAGCTCTATGGGAAGCATCACATTTCTTGTGGCTCTCCCCTGCGCA
ACGTAAATTGGATCCTGAGTTGGCTGCCTTTGCGCAAGAAAGAAGGTAGAGACGATCTCGTGCTGGCCCCCGATGGAAAAGAGTGTTGCAGCTGATCCTG
AATGGCATGATCGACGGTCTTTGTGATCTGAACGTTTTGCTGGATCCCATGTTCCTGCACTTTCCCTGTCCGAACGAGGTTAGCGTGTGGTATCCCGGTC
TTTCCGTGCAGCGGACCAACATACCCAACTTGATCACCGCTTTGTTGATCGATCATGCTGCCGAACGTTGGAGGAACCAGTTTCGTCCTTCGATCGCCTC
CCACCCTGGGTCATCTCTTCCACGCTTTATGGGTAAGTTCTTTTTTCGCAAGTGATTTCTTTGGTCTAGTCCCATAACGCGATCTCTCAATATAATTTCG
TCTCACTTCCATTCGATCGCTCCCATAATTCATTTCCTTCCCTTTCCTTTTACTTTTTTTCATCGCGATCACACCCTTGGTCTGCGATCATCGCACTCAA
TTCACATAAATTCCATTCCATCTCCATGTACAATCTCCTTGCACCCATTACGTCCATCCCCATCCATACAGCTTTCCTGCATATACACATCCACTCAATC
TCTCCGATCGTCGCTAATCTCTGGCTTCTTCTTCGTGCGATTGCATAACCTCGAAAAGGTTCCTGCTCAACCGATTGCAATTGAACTCCTGCATCATAGC
TCCACAGTTCAGATCATCTTCGTCAATCCAGGTTGGGTTGCAAACTCCTTCCATTGTATCAGGTACTGATTGTGTATTTGGCCATATCTAGTCTTCCGTC
CCGATCGCACATCGATAATCTTATCCACTACAAATTCGTCGGCGTCAAGATCACCCTCCCAAATATCCCCCGGCAGCAGTGCTTCGTCAAAATCGAATCG
ACTTGCCTCATTCAGCCTACTCGTAGGGCGTTCTGGGAACACGCGAACTAGCTTCAACTTAGAAACGTGATCATTGGGAATAGCCGGTGCGGTGTACCCG
CGATTTCCAACTTTACGGCGTGATTGGCGCACTTTCCGGCCACTCGGGAAGGTTTATGCCACGTATGGGCTAGCTTCCGAGCGTATCGTTCCTTGGCTCG
GTCTAGATATAACCAAACTCGCAACCCGCGATCGATATTCTATAAATCTCGATTTTCATTATGTCGATCGGCTCGACCTTTGATCGCAACCTTTGATCGG
TCATTCACTACTGCCCACGCACGCTGATATTGGCGTTTATGCCATATCTCCACCTTCGTGCGTCTTGATCTCGGGGTTTAGTGCTTCCCAACGATAATGT
TGCTTCCAAAGTTGATCTTGGGTCCCAACCGCGAATCCGGTAAAACCGTGTGTCTCCGCGAATTCAATCATGAGCGGTGTTGATCGCATAGGTCAATCGT
TCTGCTTATTCGTCCCAGTCCTTTTAATTTTCATCCATGACATACATCTTGATCGATCGAGTCAGTGTCTGCACCATGCGCTCGTCCGTACCATTCGCTT
GTGGTCTATATTCCATGGTGGCCCGCCGTTTTTGTCCCGCGATCCAATTGAACGCTCGGAAGAAATCGAACCTAAATTCCGGCTCGCGATCATGACATAT
CACCTCACTCGCACTGAATCGTCTGAGCACGTATTCTTCGTAATTTTCCGCGATCGTCTGTGCGGATCTGTACAAGCTTGCTTTCGCGATCACATACCCA
GAAAATAAGTCGACCCACAATAACAACTCGGTGTTATTTTTAAAAGATAGTGGCAACGAAGGGGTGTGATCCATAGCTATAATCTGGAACGGGTACGTCG
ATTGCAAATTACCAGGTGATCCACTCCGATCACCTGGTCGTCCTTTTCCGGTTTCACAATCCACACACTCTCCCACATACCGCTGCACACTTCGGTACAA
CCCACGCCAATGAAAGTTCGCCCTGACCCGTTGATAAGTACGGTCGAATCCTTGATGACCACCCTCCAAACTTGTGTGGTAGTGGTACAAGAGATCTTGC
TGTAGCTGCTCTGGAACTACCAGACGAGCCAGTTCAGTACGGTCTTCCGATTCGGTGGCTGATCTCGGACAGAAAAATAGCAATCCACTTTGGTCTACTT
CATAATCCGGTGCGACCAGGGCGCAAACTTTGGCTTCAGCCGCCGATAATCTAGCCACATCTCCAACCAGATGTATCTTCAGACTGGATATCCAATTTTC
TCCGTCTTGTGCTTGCTTAATGCGATCGATCCGTATCTGCTGCACCACCTCTTCCTGTAAAATTCTGGGCTGACAGCGACTTCTTAGGGCTGATCTAGTA
ATAGCCACCACTTTGACTGCATGATCGACTCGTTCTGGTAATAGTAATTCGCCTAGCCGATTGAGAGCGATCCGATCCTCATGATCCTGATCCGAAATCA
CAACAGTTCATTTCTCTTGCCGTAGACCTGCACTCGCTAGCGGATCTGCACTCTGATCCCAATCACGCTTCATATGCAGGAATTCATGGGCTGGTCACGA
TCGGAGTTTATCCATCGCTTTATGTCTCAGCAATTGCAGTCCTGGTGCCTTAAAATCGGTTTCTCCTCGCATTGGCGGATCACTAAATTCGAATCTCCGC
AGATAATCACTGTCACCTGGCCTGA