Description :
From Genome Similarity Track
Location :
Scaffold_4129:749- 2495
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4129-snap-gene-0.1Dynein heavy chain

Sequence
1746 bases(100 bases per row)
CATGCGTCGCCGTCATTGGCAAGAGCTCATCAAACTCACGGGGAAGACATTTGAGTGCCCGGAAGACAATCCTGATCTCCGGTTTGCCGATATTCTTGCG
TTGAATCTCCACGAGTTCCAGCGAGACGTCGAAGAGATCACGGACCGCGCACAAAAGGAGGCCAAACAAGAGTCAATCCTGCAGGATCTTGAAACTCGCT
GGGCGAATGTGGCATTCACTATGACGCCGTACAAAGAAACCGACATTCCGCTGCTCCACCTGGGCGAAGATATCATTGAGATGCTCGAGTCGGACCAGCT
TCTCTTGCAAGGGATGCTTTCGGGTCGGCACAACTACTTTAAGTTCCAGACCGAAGCATGGAACAACAAGCTGACTTTGATCGCCGAGGTGATGGCCATT
CTTAATGAGATCCAACGTGCGTGGTCGTACCTCGAGCCGCTCTTTATTCGTTCGGAGGAAGTCAAGCGCGAGCTGCCGGACGAGGCCGTGCGATTTCAAG
GTATCGACGAGCGTGTCCGATACACGCTGCGGCAGATGTGGTCTCCGCAATCCTGTGGAGGTAACGCTCTACTCGCGTGCCAGCTTCCAGATCTACTGAG
CTCGCTCACGGATCTGAGGGGTTCACTTGAAAAGTGCCAGCAGGCGCTCAAAGAATACTTGGACTCGAAGCGTCGTCTCTTTCCTCGCTTCTACTTCATC
TCGGAGGCGGATTTGTTGGACTTGCTTTCCAACGGCAGCGCACCAGAGAGCATTTTAATTCATCTCGAGAAAATCTTCCTGGCGACCCACACGTTGGTGC
TCGACAAAAGAAACGGTATGATTTCCGCGACGCATTTTGTCTCCAAGGACGCGGCGCGGGAGCGCATCACCTTTGAGCGCAACGTTGTGATTTCAGGCAA
GGTCGAGCTCTATCTGCAAACAGTTCACGAAGCAATGCAGCATACGCTTCAGGAACACGTCGCCAGGGCGATTCGCCGCTTCCCCGAACAGAACCGCGTC
GAGTGGCTCATGCAAAAACTACCAAGCGCTAACGACAAGGACGTCGGCAAGCACCCGATGGACGCAGCACAAATCGCACTGATGGTCGCTGGCATCGAAT
ACGCGAAAAGCGTGGAAGAGGCTTTTAGCTTACTTGCAAACGGTCGGCCGACGGCGATGACAGAGTGCTTTGACAAAGTCGTGATCCAGCTCCACGACCT
CATCATGCTCACGCAGACGTCTCTGTCTAAGGAAGATCGCCAGCGCGTCATGTGTTTGATTTCTATGGATGCGCACTCACGAGACATCGTGCAAAAGCTG
CTTCATGATCAAATTGCGAGCTCGAGCGCGTTCCAGTGGCAGTCACAACTCAAGCAGCGTCGCACCGACCACACGGGCAAGACGTACTTGGAGATTTGTG
ATGCCAAGTTTGACTATGGTTTCGAATACTTGGGCAATGGACCTCGTCTCGTGGTCACACCGCTCACGGACCGTATCTACGTGACAGCCACGCAGGCTCT
CCACATGCAAATGGGCTGTGCACCTGCCGGACCGGCGGGCACGGGCAAGACCGAAACGACCAAAGACCTCGCCAACATGGTGGGCAAAGTGTGCTACGTG
TTTAACTGCTCGCCGGAAATGGACTACAAGAATCTGGGCAATATATTCAAGGGACTCGCTAGTGCTGGTGCATGGGGATGCTTCGACGAGTTCAATCGAC
TTGCTCCGGAGGTGCTATCCGTCTGTTCCGTGCAGTTCAAGGCCGT