Description :
From Genome Similarity Track
Location :
Scaffold_93:749- 1957
Transcript NameFunction/comments
Phyag_g1929hypothetical protein

Sequence
1208 bases(100 bases per row)
AACGACGAGGTTGACACTGACGCAGTTCAGCTGAGTAAGGACAACCCCGAGGAGCAAGATGACGGCTCTCAATGGGTCGAAGTGTACGATCCGGtgactc
agcagcagtatTACTACTGCTCACGCACCAACGAAACTCGTTGGGATCCTCCTGAGGAACTTATCTCCTCTGCAAAGGACCGCAATGTGACTGAAATTTC
GACCCAGTGGCTAGCGCGTGGCCGTCAGCAAATATTCGAGCTCCGAGCACATTCTCCAGAGCGCAACAAGGAACCGCAGTCTTTTGGTTCGGTAGAAGAT
GAATCTGAGCTTGAGGCTACGTGTCGTCGAGAGATGAATcaccaggagctgctgcagcttaaAGGTGGCGACAGATTTTGGGGGCTGGACTTGTATGAGC
GCGAGATGATACAGAAACGAATTGAGGACGAACTCATGGAACGGACGAAGGCTTTGAACGAGCAATGCGTCTCGCTGTCTGTCCAAGGAACAAATGTGGC
ATATACTCAGCTCGGATATCCGGCCTTTGACGATTTGTACGACGAGGAAATGGATCCGGAGCGCTTGAAACGAGAACAGAAAGAAGAGAACGACGCTCGC
ATTACAATGTTTAATGAAGAAACCCAGCAGTGTCAGAACGGAGATATCTTTTGGGGTATTCAAGCAGAGGAGGCTAGGCAAAACGCTGCAAATATTGCGA
TGGCGCAAGAGGAGACAGATAGTCGTCGTTTTGCGGTCAATGTACTCGAGCAAGCACTTAGTGCGACGTGGGAAGCAGAAGTACAACAAAATGTTGCGAA
AGAGCTAGCTGCGCGTGGTGGATTGGAGCAGCGGATGCAAGAAAGGTATCTTCATTGGTTCTACCGGCAGTGCGTTTCAGTGGATGAATTGCTGGGGTAT
CGATGGCCGaccaagcaacagcaagaatgttttcaagaagaacctTCGCCAGTCAAAAAGCGGCGATATCCCGTTGTTGAGCCAAATCCAGACGCTGTTT
TTTCAGCGACGCCATACCCTCTGGATAACTTGGTGGTTCGCGACCGACTAGAAAACGGAGATCTACGCTACGGCCTTCGATCCATTTTGACTGTTCACCA
TCAGAGTGCTCGTGGAACCAACGGTGCTCACTTTGAGATTACACAAGCCTCTCCAGAGTGTGCGTTCGATGAAACCACAGCTGCAGTGATCTTAAAATGC
CAAGTGCA