Description :
From Genome Similarity Track
Location :
Scaffold_30:748996- 751321
Transcript NameFunction/comments
Phyin_T30-4PITG_13816Putative uncharacterized protein
Phyin_T30-4PITG_13817Putative uncharacterized protein

Sequence
2325 bases(100 bases per row)
TAGGATCATGTGGGAGAACATGCCGACCGGTGGATGAATCGTAGATGCAGCCGGTCGCACATGCATGTGCCTCTGCTGGAACAAAGATGGGGTTTGCTGG
GCTCCCTTGCCCTGGAATTCCCATGCAGTCGCAGAGATTCGAACGTCCGGCTCACCAGCAAAGATCGGTGCGGAGATCGGCTGGGGATGGAGAAGATGCA
GCTGGTGTCATAGCGGAACCGGAAGCAGGTTTCCCAGTGTATGGTCCAGCGACGTTGGCTGATAGCCAGAACAACACGGATACCAGAGCTGATGCGCCGC
GCAATACGAGTGCTGATTCGATTAGTGACGTCGTGGGTGTAGTTGTTGCTGCGGCCAAACAATGCGAAGAATCTTTCCTTCATTTGCTGCGTTTGGAGAC
TCCAGTCACTAATACTCTGCGTAGGTCCTATCGGTCTAGGACTCCCACGCGTAGAGCACGTGCGGCAAGGGCTCAAAACAAGCGTAGACGCAGGTGAAGG
ATCGGCCTTATGTTTCGAAAGAACAGGCTCCGCTCCGATCATTGTGAGCCGATCATACTCTATAGCTCTCTACGTAACATCTGCCAATCATTTTTCTCTT
TACATCCATATATGCACTTGCACTGCAAGTTGCAGCTCTTGTTTGTTGCCACATTTAGGTTCTTGCGCCAGCAGGCCGAGAAGTACCTGAATACATGTGA
GGCCGCATCTCCCAGAATAGGCCATATCAGACCCTACGTCTACTCTCTTCATGAACTATGACGCTGCAGTTCAGACTGTCAAGCCTCGAGCGTCTCGTCC
TGGCTTTCGTAAGCGAAGGTTCAACACGTCATGGTGTAATCCAGTCGTGGGAAGGGGGCAAAGGAGCCAACGTCCAGCTCAATCTACTTATGCTTCCAGC
AGCAAACACGCACGGAACTCAGCGCCCTCTTCGTCACCGCCTCCTCCTGTCAATACCAACACAGTAATGCCCCGTCGAGCGAATCTGAGCGATCCGAATC
CTTTCTACAACGACATTGCGCCGTTGTACGCCAAGTTCCTCAACTCAACAGACGTCAAGAGGGTTTTGAAGCAGTAGCAACGATTTTTTACTAGTTGCAT
TTAGCAGTTGGTTGCTGGTAAAGTCCGAGTGTAAGGATTCCATGGCAAGGTCTTAGGAGAGACGAATGGGAACTTGCCACCGCAGAACTCTACGACGGAT
AGAAGCTTCATTGCGCCAATGCTGTCCACGTCGAAGTACACGAAGATGTGGATCACTTCCTTGTCGGTCATCAGCCCGCGAACGGCGCTGTTGGCAGGGA
GAGCAGCTTCTGCTGCGACGAACGCCGTGCGGAAGTCGTGCAGTCCGATGTATTCGCGCTCTTCCTCCTGTTGTGGCTGGTCTGCTCTGGCGTCCGATCC
GTGTCTTAGCGTGTCGAGAAGACGTCGAGTCGTATCGGGATCTCCCTTAAGCAGAGTCAGCAGCCCCCTCAACGCTGAGCGTTGGTGCACACTGGTCGAT
TCTTTCATCGTGAATGGCACCAATCTCGGTAGCTTCTCCGTGGCGCTTGGTCGGGTCGTTGAGCTCGTTTGTGAATGTGCTGGACCGACCAAAGGCGTTT
CTCCCGTCCGAGACAGTCGTGGCAAAGTTCAAGCCACGGATTCACCGCTTACAAGTACCTGGTGACAGTCGTGCTCTGTACTAGATCCGGTTTCATTTGG
TCGATGCTGTCAGTCTGTGCCTTCGTCAAATGCTAATATTTGGGTCCACATGACGAGCCAGAGAGCCATCGCGTCCTCGAGGAATCGGCTCCTTGACTAG
CGCCGACGTGTCCACCGGTAGGTACGAACTCGCTATCGTCGTGAGTGCTGCTTCGTGGCAATCGAGTTGTTGCTCCTCTCGTTCGCGTGCACGCTGCTTA
CTGTGAAGACGCTGGGCAGTCTCAGCTAAGAGCTGGCCACGAAGAAATTTTCGAGGTCCAGACCCTGGCTTAGCTGCCGCGTAGCCGGCGTACCGGTGGC
TCGCTCGGAGTGTAGTTTCGAACAGAGGTGATGTGATCTCGCTGGCATGACTGCTGCAAGTGATCGTTGCAGGTTTATCATCCAGGAGGACACGCTCGTA
TGTCGGCTCGATCCAAGACTCCTTTCGATCATGACATCCACAAAGAGCAGCAATTTAAAAGCCCACAGCTGAGAGGCTGAGAGCGATAAGAAAACTACTT
TCCTGGTGCGAAGTAAGGTGCTGGTACCTTTCGACTGGCGTTGCCGGTCTTGTCACGGAGAGCGTCTTCCTCGACCCAGCTGCCCACTAGAGAAGCCTTA
TTGTTCCTCACGTTGTACGTCGTTG