Description :
From Genome Similarity Track
Location :
contig_5:748987- 750393
Transcript NameFunction/comments
g1677.t1hypothetical protein

Sequence
1406 bases(100 bases per row)
CGTTTATCTTCACGAGCAACTCAATCTTGCCTCCTGCAGACGATCGCGGCACCCACATGAGCAGCGATCCTCCACCGGAACCCGGCACATCCAGAAGCCC
TGGACGCCAGCGGTCGAGATACAGCGTTTGGTCCTGAAGAGCCTTCACCGTCGAGTTCCACGACATCGTCTCGCCGCTCGCCACGTCCACCTCAGCTACC
GTGTCACCGCCAGAGTGAATGACCACCGTCACATCTTCAGTGTCAGTGCTCTCGAACGTTATGTTCACCGAGCCATCCCCAGATTTACTCCAAGTGCCGC
AGCTGCCGTTGAAAGCCTGGTCTTCCGTTGTGAGCGCTAGCGCATCTGCCAAGGAGCCATCATCGATCTCTCCGACAAAGGACGTAGGTCCGCAGATGGG
TTGGATGAAGGTGGCCATCATGTCAGCGATACCAGTCGGATCGAGCGTGGCGATGACGTCCAGGCCCATGTCAGCCACCGACACAAGGTAGTCTGACGTC
GAGATCGCGTTTCCGTCATCGTCCACTGCTCCGTCAGCCAGGCCGTCCGTGATTGTGCTCATTACTGTGCGCAGAGTGTCTCGTACACTGAAAGCATCGT
CCGTGAGGTTGCGGATGCAGGTGTTGGTCACAGCGGGAATATCCTGAAGGAAGAGTCCGAGACGCTCAGAGCCTCTCGGATATTGCTGACGGTGCTACTG
GGGTCCTTGGTCTTGATACCAGCCACGAACTGCGTCACCTTGTGGATAATCGTCTGCAGCTTGGTGCCGCACGTTGTGCCCGCCGTTAGAACGTCTTGGA
GCTGGGCGACGCTGTCCGTGTCGAGGTCTTGAACAGAGTCGTCAACGCCAATGTCGCTCATGAGCGCCAAGAACGTACTGGGGTCAAGCAGCGATGCTCC
ATTCTCAACCACCTCCGTAACAATCTGGTTGACGGCAGCAACCACGTCAGCACTGAGCTCCAACGTGTCAGTAGACACCGGGAGTCCGAGGCACGTGCAG
ACAGCCGCAGGCAGCTCGTTGATGACGAGATCGACTGGTTCACCACGCTCAGTAGCTGCTCGCTTTGCGTTGCGTTAGCCTGGAGCTCGTCCACATAGCT
CACAAGGGAGCTTGTGGCTGCGAAGAGCGACTGGCCGCACTTGACACCGAGCTGCAGGGCTTTACTGGCCTTGATGAACTCGCCGAAGACGCCAGCCGTA
GCGGCATTAAGTGCCACCGTAGCAACCGACGTGACCTTGTCCAGGACCTCGGAAGTGCAGTCCGAACTCTGTGGAATACACTCCGCGCCGCACTCAACAG
GAAAGTTCAAAGGGCACTGCGCCCAGCATGATGCAATTCCATCAGACTCGTAGCCTATGGCGCAGGTCTCCGAAGACAGGTACGTCTTGCGGTAGCAGGC
GGAATC