Description :
From Genome Similarity Track
Location :
contig_5:748936- 750379
Transcript NameFunction/comments
g1797.t1RAW28644.1 hypothetical protein PC110_g14981 [Phytophthora cactorum

Sequence
1443 bases(100 bases per row)
CTCCATCGCCATTTATCTTCACGAGCAACTCAATCTTGCCTCCTGCAGACGATCGCGGCACCCACATGAGCAGCGATCCTCCACCGGAACCCGGCACATC
CAGAAGCCCTGGACGCCAGCGGTCGAGATACAGCGTTTGGTCCTGAAGAGCCTTCACCGTCGAGTTCCACGACATCGTCTCGCCGCTCGCCACGTCCACC
TCAGCTACCGTGTCACCGCCAGAGTGAATGACCACCGTCACATCTTCAGTGTCAGTGCTCTCGAACGTTATGTTCACCGAGCCATCCCCAGATTTACTCC
AAGTGCCGCAGCTGCCGTTGAAAGCCTGGTCTTCCGTTGTGAGCGCTAGCGCATCTGCCAAGGAGCCATCATCGATCTCTCCGACAAAGGACGTAGGTCC
GCAGATGGGTTGGATGAAGGTGGCCATCATGTCAGCGATACCAGTCGGATCGAGCGTGGCGATGACGTCCAGGCCCATGTCAGCCACCGACACAAGGTAG
TCTGACGTCGAGATCGCGTTTCCGTCATCGTCCACTGCTCCGTCAGCCAGGCCGTCCGTGATTGTGCTCATTACTGTGCGCAGGGTGTCTCGTACACTGA
AAGCATCGTCCGTGAGGTTGCGGATGCAGGTGTTGGTCACAGCGGGAATATCCTGAAGGAAGAGTCCGAGACGCTCAGAGCCTCTCGGATATTGCTGACG
GTGCTACTGGGGTCCTTGGTCTTGATACCAGCCACGAACTGCGTCACCTTGTGGATAATCGTCTGCAGCTTGGTGCCGCACGTTGTGCCCGCCGTTAGAA
CGTCTTGGAGCTGGGCGACGCTGTCCGTGTCGAGGTCTTGAACAGAGTCGTCAACGCCAATGTCGCTCATGAGCGCCAAGAACGTACTGGGGTCAAGCAG
CGATGCTCCATTCTCAACCACCTCCGTAACAATCTGGTTGACGGCAGCAACCACGTCAGCACTGAGCTCCAACGTGTCAGTAGACACCGGGAGTCCGAGG
CACGTGCAGACAGCCGCAGGCAGCTCGTTGATGACGAGATCGACTGGTTCACCACGCTCAGTAGCTGCTCGCTTTGCGTTGCGTTAGCCTGGAGCTCGTC
CACATAGCTCACAAGGGAGCTTGTGGCTGCGAAGAGCGACTGGCCGCACTTGACACCGAGCTGCAGGGCTTTACTGGCCTTGATGAACTCGCCGAAGACG
CCAGCCGTAGCGGCATTAAGTGCCACCGTAGCAACCGACGTGACCTTGTCCAGGACCTCGGAAGTGCAGTCCGAACTCTGTGGAATACACTCCGCGCCGC
ACTCAACAGGAAAGTTCAAAGGGCACTGCGCCCAGCATGATGCAATTCCATCAGACTCGTAGCCTATGGCGCAGGTCTCCGAAGACAGGTACGTCTTGCG
GTAGCAGGCGGAATCTGTCACATTGATCGGGCTCACCCAGTTG