Description :
From Genome Similarity Track
Location :
Scaffold_7:7488- 9091
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003503tubular mastigoneme protein

Sequence
1603 bases(100 bases per row)
TTTTTGTAGGATCTGTGTTTACCGCCCACGTATTCGTCATCACGATGTTTGAGCCCACTTTGATCAGCGCCAGTGTGCCGGAGGTAGGCAGATTACCTGC
GCCTGCGCCTGTGACTGTCAAAGTAGTTACCCCAAGCACCGGTGCCGTTCCAGCTACAGTCGCCACTGCTGGAGCTGTGAGCGTGGACTGCTTGGTGAAC
CATTCGTCGTTCTGGCCTTGCTCACCCGTAGTCACAACCATCGCCTTCTTGGCCGTTACGCCAGAAAACCCGAAATCTACCACCTCTGGGATGCGATGTC
TACCGGGGTTGTCGATGTACTGGCAGATCACCGACATGCCGAGTTGGTTCGTGTCTGTCGCTGGCCAAAGCGACAAAAAGTCGCCTAAATCACCGGTACC
AGTTCCAACGACCTCGCACGTAGCGTCGCGGAAAGTAAGGTTCGGGATGTTCTTCAGCGCATTCTGAACTGCTGCGGCGTTTAAAGGTTTATTTGCTGGC
GTAGTTTCGTCGAGGATCGTGATCTTGGACGTGATGTAGGACTCGCCATAGTAGTCAAACACACGGAGGCGGATCCACGGAGGACTCGCAGTTGGGTACG
TGATGGCTGCGGTTTGATCAGCGAACGCATGAATCGCAAAGGTCTCGTAGATTGGGGTACCGATGGACAAGTACAACGGATCAACACCCACTTTGCATGT
GCGCTTCGAGCAGTCAGCGCCGCGGAACCACGGGTCACAACGGCACCCATACGTCGAGTTGCCATCCCAGAGGTCGTACACCACCGAGCCACTTGGATGT
TCGATGCCAAAGAGCGTGCCTTCGCCCTTGGCCCCAAGCTCACGGATGCTCTCGCACGTACCATGGCCGTTGCACTTTCCGGGACACACGGTGCGCTGGC
AACCAACACCCTCGTACCCGTCAAAGCACGTGCACAGACCCGTGGAGCGGTCGCAGATGCCCTTGTTCGAGCACTCCATGTAGAAATGCGCTTCGTTTTG
CTTGGCGTCCGGGTTGAAGTACTCGTAGGTCTTGGCGGGGTGCTGCTGCGAGTTCTCAAGGATCCAGTTAGCCGTCTTGCGCGTCTGGTCCATGTTGATG
TCACCCTTAGGAGTGTCGACGTGCGCGTATCCGAACACGCACGTGCGGTCGGCGCAGTCGTTGCCCTGGTAGTTCTTGTAGCAGTTGCACATATCCTTTT
GCATACACGCGCCATTGCCGGAGCACCCATTTGGGCACTCGGCCGTGGCAAAGCCCACGAGCAGTAGGAGCAGCGATAGCGACCACAACGAGACGCACTG
GCGCATTGTGGTCGAGTCAGGCGTCGAGCGAGTTCTTGGTGCCGTCTGTGACTCGGTAGGTCTCCGTCTTTGTGCCTTTTCGGTTGTCCTGCTTCTTCGG
GAATGAGAGATTCTCAAGCCTTGGCGCACCCATCATGGATTCCACGGGGCTGCTCTTGTGGCGGCATTCTGAAGAGCCGTTAGCGAGCGAAGTGCGAATG
GTTGCCGCGACTTTTAACCGCCCTCTGGCTGTTTCCATAGTAGCAAGTAAGCTTCGCATAATGGAGCTCCAGCTTGTCTGGGCGTCCGTTGCATATTTCG
TGG