Description :
From Genome Similarity Track
Location :
Scaffold_910:7488- 8655
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_910-fgenesh-gene-0.2HECT ubiquitin ligase
Pytiw_DAOMBR242034maker-piw_contig_910-fgenesh-gene-0.3HECT ubiquitin ligase

Sequence
1167 bases(100 bases per row)
GGCTGTCGAAAGCATCGCCGCTCGTCGTGAGTGCGCTGTTGTCACGAGCCGCAGATGCGCGTATGAAGGTAGGTGGTGCGGCAGTTCACCTTCACATGAG
CTTTATGAATTGGGCCTGGTTACGGATTGATTTTGAGCAGGATTTTTAATCTGATTATTTAGCATACACCCTCTTTTCCGTGGATGCAGAGTATTTACGC
TAGTGAGTATATTTAAAATTGATCTCTCTTTACTTTCAATACATCAGGTAAAATGTGGATACTCATTATGAAAGGAATTTTTGCACCCAATATGCATATG
AAGAAGACTACGCAAGACCCAGTATGCAGAGCAAGAAGACCACCAGACATAGCAACACAATGACAGACATGAGTCACATAGCCTGGGAGCATTACCGAGT
TCTCTCGGCAACGCCAGAGCGACACGGAAGCTGCAACGCTTTCAGGTCGCCTCATCTCATCTCATCTCGCTCCTCGTCTCTGAATTCCACCGCTAAACTC
GACGCTTCTCGGCTTCTTCAAACGTGGCCTAGAAAACGGTTCTGTGAGTTTCAACTTTCGCCTTCTTCAAGCACCAGACTTTAAACCACAAAGCTCATTT
CACCTACAAAGTAACATGTTCGCTGCAAGGCTTGGAGTTCCTCCACCAGAAGTCTCATCCCAAGTATTAACAAGTTTCATCATACTGATGCGAAACTAGC
TCTCGACATTTTTCCGATTAAGAAATTACAACCAACCAATCCGACAACCAACCTTCACAGAGGTCCTTGTCGCAAACTTACTTTGAAAAGTCGTAGTTGT
CAAGAATCCCGAACAAGTTGGACGTGAGCTCCTTCTTGTGCACGTACGTCGGCAGCTCCATCTGGTTGAAGCACGGCTGCGCGCGCACGAAGCGCGAGAT
CACGAGCTCCTTGCCGATGATCGTGAAGGGCGCGACGTGGCCGTTGTGGTTGGTCAGCTGCGCGAAGCCGCCGATGGGCACGCGCGTGTTGCCCGTCGTG
AAGTGTAGCAGGCGCTTCTTGTAGTCGAGCGACATCTTGCGCGTGAACGCCCAGAACCACTTCTTGGACGGGTGCGCGTGGATCGTCTCGTTGTAGCGCG
ACGTGCGCTCCCACTCGTCCGCGTCGATCACGTCCGAGCCGCACATGATGTAGTCGAGCTCCTCAGC