Description :
From Genome Similarity Track
Location :
Scaffold_17:74858- 76866
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007179Similar to DSPP: Dentin sialophosphoprotein (Homo sapiens)

Sequence
2008 bases(100 bases per row)
TGTAGACGCTCTTCCGTGATGGTTCGCGGCGACGTGCGCAAGGACAACCAGGGATTCGAAGACATTGACGAATTCTGGGCTGACGACGACGATTTCGACG
CAACAAACGACGACGATGACGACGAATACAATGAGAGTACGTGACTTCTCTGTTTCATCTTCATGCCACGTGCGCGTTGGGAAAAAAGGAGTCCCTCATA
CTATGCTTACCACATGATGCAACAGCGAGCATGTCAGAGCGCGATCTGTCGTCGGCGAACGTGTCGATGGGCTCGTTGACGAGCGAGCGCCAAGTGCGGC
TCTCTGGGGTCAGCACGCAAAGCAACGACTTCGAGTTTGGGAACGACGGGAACATCTCCACGGACACGATGGACCTGGAGGAGGAAGACAACGTTCCATT
GGGGCAGATCGTGGCCAAGAGCAACGGCAAAAAGAAAGCTGCTGCCCCGACATCCACGGGCGCGTTGGCAACGCCCTCAACTGCAGCGACGAGGCCGAAG
AGTCCAAGATTCTCCAAGTTCAGCACCGCATCATCTCCTGCGCTAAGCCACGACTTCAACGTCAGCCATTCGTTCGACACGGGATCCGCCATGAAGGCGA
TCCCGATCCCCGCAAAGCGCGGCAAGTCCGACTTGGTGGATGTCAAAAGACTCATTGCGCGCAAATCGCTGCCGAATACGAAAGCAGACGATGGCTCAGC
CACCAAGTCGAACCGCAAGAAAAGCAGGCGAGACGATTCCTTCGGTGAAGGTGCCGGGTTTGGAGAAGTGAACAGTCCGTTTTCGCTTGGAGGCGATCCA
GTCACCCCGCTGTCCAATGGTACGTGCGTCTTACATGTGATATGCTTTGCTGCGACTGATAGACTAGTGGACTCATTCTATTCCTTGTTTTTGTCGACTA
AATCTGTAGCGAGTGAGCGAAACCTCGACTCGATCAAGTTTTCCGACAAGGAATCTGCGAACTCGCCCAATATTCGTGTCAAGCTGTTCAAAAATGACGA
CGATAGAGTCGAGAAAGAGAAGAAAACCAAGTCGAAGGCGTCTGCAGTGAAGAAAACGCCGCCGACAAAACGACAAAAGACCGCGTACAAGTCCACGCCG
ACGTCAGACGACTCCATGGACCAGCAGACCGACAACGATAACACGTTCAACGCCAGCAGCGAGGATGACAACGACGACACGCTCTCTCATGTGGACGATG
AAAGCGACACTGAAGGCCCGAGACGCAAGAAGAAGAAATCCAGAGCACGCGAGCGCGATCTATCGTATGCGCAAGACATTCTCGACGATGCCGGCAATGA
CAATGCCTCGGGCGTGCGACGATCCAAGCGCAAGCGCTTTAAACCGCTCGCATGGTACAAAGGCGAGCACTACGTCTACGAGCGCCGTGAATCGGGCGTT
GGGCTGGTGATCCCAACGGTGGCAGGCATCGAGCGCGTGGGCACGACGACCCCCACCAAGACGGCACGCAAGTACACAAAAAAGTCGCATTCGAATCCAC
AGCGGAAAGCGATCAAACCGTTCCCAAAGAGCAGTCTGCCCAAGGGCTTGAAGTACGAAGACGGCGAATGGGCCGATTTGTATGACACCTCTGCCGGTTG
CATCAACAAGATGAACGTGATCTGCCGCGCAAGCGAGATCGAGCACCGCGAGCTGCCCAGTGTCGACGGTGAAGTGCCGGGTTTCGCCGGCCAGAGCTTC
AACCTGCGCAACTCGCACCCGTTCTCGCGATGGATCTGCGGGCGGTTGGGGCTGCCGCCTGGCGCTGCAAAGGAAGCCGAGAGCGTGGGCGAGGCCGTGC
AGGTGTTCTACGTGACCAACTGCCAGCCAGGTGCCGTGGAAGTGTCGTTTGGGCCCGTGACGGACGAGTACTTTGACACAACCAAGGCGACGCGGTTCCT
GCTGAACCCTGGCGACGAGTTCTACGTGCCGTCGCGCAACGCGTACTATTTAAAAAACTATTCCGAGAAGGCGACGTGCGACCTGCACTTTACGATCATG
AAGCCTGA