Description :
From Genome Similarity Track
Location :
contig_34:74848- 76726
Transcript NameFunction/comments
g8128.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1878 bases(100 bases per row)
ACGTAGCCGTCATCACCGCTTCACCCCAATACGTCTTGGGCAATCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTC
GGCCACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTTTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCA
CCGTTGTCGCTCCGGAGTGTCTGCACGCACTTGCCGGTCTGAGTTTCAGCAAACGGCCCAATCTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCA
GCAAGTACACGACGCAGAAGTGCGACTTGTCATCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCACT
GTGAACCACCTCCAGCACGTGCTTGGCACGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCAC
TGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGT
ACGACGTGGTGTCCCCTTGGCAATCCTTCGAACTTGCCGCATTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACG
AGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGCCCCACGTCCTTGGTGAAGCGGCCGACCGAAAAC
AGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCA
CCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCTTCTTGTAGTTCCTCATGTACTTGTTGGAACTCGTCATGTGCTGCGTCGC
ACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTGCTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACG
TTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGG
TCTTCTTCACCGGACGTCCTTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTT
GCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCG
CTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCT
CCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCT
TGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTC
TTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCT
TGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGA