Description :
From Genome Similarity Track
Location :
Scaffold_519:7484- 8886
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_519-snap-gene-0.14Methyltransferase 11 domain containing 1

Sequence
1402 bases(100 bases per row)
ATCTACTTCTTGGCAAGGTAGACAGACGCATCGGCCGGCCACGAAGCACCCCAGTGCGCCTTACGAGCTGCACGGTAGACTTCGCGGATCGCTTTGCCCT
TGGTTACGCTGCGGCGCTCGAGGTTGCCCTGTAACGTGTCATATCAACACGGTGAGCCACGGATGCAGaGACGaGGGGGCCGAATAGGACGCACCTGAGG
CATGCACAGATCGAGGAGCACGTGCTTGTTGGCGAGGAGTGGGCCACTGGAGATGGATACAGACACGGTGAGACTGCTGCTCATACACCATCACTTGCTC
ACATTCCCTATCACGTACCGGATCAGTCGACCGAGAGGCTCGGGCTTGGCCTCGaCAATGTCGCGAGTCTTCTCCATGACGACGTACGAGAACTTGGACA
CCTTGTGTCCGTGCCAGCGCTTCGTGGTGACATCTCGAGGGAACTGCACGCGTGGTGAGCGCTGCaCAAAGTGACACCACGTCTTGCCCTTCgCGGGGCA
TTCTTCCTGATGAGGACACGGGGCCAGAATCTTGGCGCTCTCGTCTTGCTCGTCCGCGACCGAGTCCAAGATGAACTGGCGCGCTGAACGCACCTGGTGC
GAGCCCCACGTGCTGCCACGATCGACGATGACGAGTACGCCGTTGTCGGACAACAACTCCCAGAGCGCCGACATGATCGCCACACGCTCGTAGTCGCTCG
TGATTTCAGACAGCACGAAGTTGAGCACGATAAGATCGTAGCTGAGTCCGTTCTGAATCTCGCGCTTCATCTCCGAGATGCTACGACGAATACTGAGCCC
AGGGAAGCCGTCGAGCAACACTTCGGCAGCGTCGACCATCGACTGACTCGGCTCCAAGACGCGGTAGCGGGACAGCGAGTCTCCATAGTACTCCTTCGCC
ACCCATGAGGCCGTGCCCGGCCCCGCGCCAAAGTCCAGCACGGATTCCGGCGCGAAGTCTGGGCGGCGTGTCTGCAGCTGACGGAAGGCCTGGTGGGTGC
ATGCGTACGTCATCTCGACGTCCTGTGCCAGGTACGCCATGGTCTCGCCTGGACCATATAGCATCGGCTTGATCTGTTCGTCCTTGTCCAGCGTCCAGCC
GAGCGGgCGCTTATGCATATCGAGAGGAATCTGGCGGTCGTTGTTCGCCTCGTCCGCCTGTAGCTTCTCGCGTAGCTGGATGAGCTGCGAATGCGTGCGG
CGCTTGACAATAGTCGTGAGGCGATTCAGCATCTCCTGCGGCATCTCCACGCGGTTCGTGAGGCCGTTGCGCGAGATGTCTTCGATGTTGGCCACGAGCT
TCAGTGCCTCACGCATCTCACTCAGGCGAGACGACACGCTACTGCTCTTGGAGGCGTCCTCCTCAGGCTTAGTGCGTCGCTGACGCCTGGCACGGCGGCT
GG