Description :
From Genome Similarity Track
Location :
Scaffold_56:74833- 81829
Transcript NameFunction/comments
Physo_137643reverse transcriptase

Sequence
6996 bases(100 bases per row)
ACCCACCGCCAAGGCTGCCACGAAGCGCAAGTCGCCCAAGAGGAAGAAGAAGAAGCTGCGCGCGCCGGACTCGGCGGAGGAGTCGCTGTCCAAGCCGCAA
GGCAAGGACACGGGACGTCAGTACACCGTCGAGGAGGTACGGTACGTCGTGGCGCGCACGGAGCTCTTCCGTCTGCTAGAACAAGACCCAATCTTGGTCT
TCCTCAAGCCCATGCTGATGAGCAACTTCACAGGCTCCTTCGTGGCGCCGGACTTCGATAGTCTCACCAGCGTTGCCCACGCCGCGCCGACTCTCTTCCA
GATGCTGCGTGACTCGGGGTTCGTGCTGGGGGCTTTCGAGATGGAGAGGCTGTGCGATTGGGACCTCAAATCTTGGTTACGTGCGATTCGCGTCGTGCAG
GAGCCCTTGACGATTCTCGCCGGATCCGTCAAACAAGACGCGACGAGTTCCGCGACGGGCCAAGACGCGCCGAGTCCCTCGGCGGGCCCAGCCCACCACG
CCCTCGCCTCCACCTCGATACCAATCGAGCGTGGACTCCGACAGCAGTTTCGAGTCGCCCAAGCGCATGCCCATGAACCGGCCGCCGCGCGTCATGCAGC
TATCCGCGGCGCCCGCACGCACGGAGGTGACGAAACCCGCCGAGGAGGTGCTTCCCAAGGCCTTGAGAGAATCCATCATCAAGTTGATGCAGACGACAGT
GATGAGCGCCCCGCGCGCCGACACAGCCGCAATTCCGACGGGGCCGAAGCCGCCCGCGAGTCCCACACTCACGGTGGCTCGCCCCCAGGAGGCAGCGGAT
GTCGCCATGGAGTCGGTCAGTTCGCGTTCTTCGACGAGGTCCAGAACTCGACGCGACGCGGACGAGGACCCCGATGACCTGTTCGACTTGGACATCGGAG
TGCCAAGAACCGCGGCCGCCGTCTCGACGGCGACGCCGGCGGCGTCGCCGTCGCCCGCGTACGCCTGTCAGGATCTTCCGAGCTGAAAGAGTTCTTGGGA
CGGGACGCCAGCGAAGAGAAAGCCCGACTGTGGCTCAACCGTCTGAAGGCCGCCGCACGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAGTTCA
GCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCTGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTCCGTGTGCAGTA
CTGCGGCAAGGGCGTGTCAATGGCCAGCCGCTACTACCATGCGGCTCCGCGCCCCGACGAGACCCCTCTGGATTATTTGTACCGGCTCAACGTCGCGGGC
TTGAGGGCCAACATCCGATACGCCGAGGGTACGACTGAAGAGAAGCGCGAAAACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCTGAACTCG
CCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTGGATTGGCTCACCAGAAAAAGACTCTCTT
CGGCTCGAACAAGTTTCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGACTCGGAA
CGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTTGTCGCGGGACAGGCCCCGCCGGCAGAGC
CGGCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACTGCCCGCGGTTCCGCCACTCTTGTTCACGTCGCCATGTCGAAGGAGACTGCTGGAAGTT
GTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCCCGATG
GAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCCGCCAGCCGCCGAGAAGATGTTAAACTAGGACGCTCGCT
GGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAGCCCGAGTTCCCTGAAT
GATAATACATGTGAATCCAACCCGGAACGTACCACGCAAGAACGCGCGCCGCGAATCTCGGCGGTCCGACGTACGACGTACGACGAGTTTGCACGTGAAC
CACCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGAAA
GCTGAACAGCCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATGCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGACACG
GAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAATATTACCTTGGCTGGGAACTTGGTGTACTACA
TGCACCTGTGGGTCGGCGACTTGGTCAGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAGTGCGCATCGACACTGCGGACGGCACGGC
GTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACTCGGTCAACGTCAAGACGCCTGTGAGGCTCGAA
CCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTTGTGGGTGACACGGGCAGAGTCGTGGGTGACTACCTTTGTCAAGGGG
AGAGTCGGAAAGAAAACGTACCTGCGTGTCACGAACATCGGAGACGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTGGACGCCGTCTGACG
GCCAGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCCGGCGTACGGCGCGACGCGCGACGCGGAGGAGAACTG
GATCCCAGCCGAGCTCGACGGACCGATGACGGATCGCCCCTCATACCCGACGCCTAAAGCCATCTTGCACCCGGAGCCGAGACAAGTCGGGACGCGACGC
GCCGTGACCCCAGTGTTGGCGGCTGTCGCGGAAGCGCCGAAGGGAAGGGGGGTAGACTTGCCACCCGACGACCACAAGCCGGATACGGACGAGGAGGCGG
TGGAAAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCGCTGCGATGGAAGAATCGCCGGAGTCGGAACTCGCCGAGCCAAAACTCGACGGACCAAA
CCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACAACGCGGTCCTCATCCACGAGGGGTCCGACCTCTTCGTAGAGGATCTC
GAGTCTGAGATGGCAGTGCTGCCAGACCTCTCGCTGACCGCCGAGGTGAAGAACGAGGACTTGAAGGTCGGCATGCCGACTGGACTCCCGCCCGAGGAAG
CCGCGAGACAAGAAACGCGGCTACGCCAAATCATCTGGAAGCGACGGAAGTGGTTGATCGGCAAAGGCAACGCCTTGCCGCCGGCCGCCCTGGGTGTTGT
CTGTGACATCGACGTGGGCGACGCAAAACCCGTCGCGCAACGCGTCCGGAAAATCCCGCCGCAGTTTCGAGAGAAGGTCGCCGGCTTGATCAAAGGGCTG
CTGAGCGCGAAGATGATCCAGAAGTCGAAGTCGCCGTGGGCGTCGGCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATTGACT
ACAGGCTCATCAACGGGCTGACACAGTTGATGATTTACCTCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCTCCAT
CGACATGGCGAGCGGCTTCTGGGTCGTCTCCATGACAAACCGGGCCCGGCTCATCTCAGCCTTCATCACGTCGATGAGACTGTACGAATGGCTGCGTTTG
CCGTTCGACCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGGGACG
TCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTACATCGACGACATCCTCATCGGGGGCACGTCGTGGGACGA
CCTGTGCGAGAAGGTCGAACGCTTGCTGGATGTCTGCGAGCAGTGACACTTGTCCATCAGTGTCGAGAAGAGCGAGTGGGGCATGTCCAAGGTCAACTAC
CTGGGCCACCGAGTCTCAGGACTCGCTCTCGAGGCGAAGCCGAAGAATATGGAGTCGCTGACGTCGCTCGAGTTCCCGCGCACGCTCAAGCGCCTGCAAT
CGTTCTTGGGTAGCCTCAATTACTACCACCGGTTCATTGCAGACTTTGCGGTGTATGCAACCGCGCTGTATTCGCTGACGGAGACCGACTTCAGCGAGTA
CGTCACGCATCCAGAAGTCCGCGAACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCGCTCAAGGCAAAACTCGCCGAGACCCCAATGTTGAAG
CACTTCGACGCGAACCGAGAATCCGTCGTGATCGTGTACGCCAGCGACTGGGCCATCTCAGGGGTGCTCACGCAGGTCCACGACGAAGTGTACATGCCTG
TGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACAC
GATGCTAGCAGGGAGACCGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGCC
GCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGTGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCG
TCGACGCGGCGCTAGAAGAGATCGCCCCACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCTGACGTGGCGCGCGACGAGGTCTTGCACGTTTT
GAGCTTTGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCATCTGCCGAACTGGGAGATCGTGCGTGCCGCGTCGGGA
TATGCGACGGACCTCACGGTCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAACTCGACGACGTCACCCGACTCGTCGTAT
GCGGAGACTCCAACCTTGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAACGCACTCCA
GGCATGGCCGCGCCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGCCGCAAC
GCGCACAGCCCCGAAGAGATTCAAGATCTGAAGAGGCTGAATCGCTTGGAAGAAGTCATCCGACCACGGGCATCAAGTCCCGAGATGGCGTCTCCAGCCA
GTCCCGACACGGATAATCTTGACGCGGAAAACCTCGACTCGGAAAATCGCGACGCGGAAAATCGCGACGCGAAAACGCGCGGCGCAGATGGCCCCGCCGG
GAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGACAACACGTAGGGTCCGACCTCCAGAA
GTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGCG
GCGACGTCGAAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCCTGTGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCTCTACCACCAGCCGAG
AAACGACGATTCCGCCGAGGATCGCGATGTGATGATAAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAA
GGCGGACACCAGGGTATTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGAGATCTTCAGAAGCCTCCAGCGCTACGTCGGCGAATGCA
CCGACTGCGAGACGGGAAAGGGTCCGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATAT
TCCGTCGTTGCCGGCATCCTACAAAGCCAACACAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCGTCACGAACC
GCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACT
TCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCAAGCGACACTTGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGT
TACAAGAGCGATCAAGATGTACATCGCAGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTTGCGCTAAACACGTCGCATGACCGG
ACGAGGAATGAAACCGCGTTCTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCGACACTGGCCGTCGGGAACACGTCGACCCGGGACGCCG
AGGCGAGGCGGTGGAAGCTCCGTATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGAAGAGAGAGCGCGTCG
ACAAACTGAAAACGCGACGCGACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCCGGGTATGCGCGCAAACTCGC