Description :
From Genome Similarity Track
Location :
scaffold_919:7482- 10536
Transcript NameFunction/comments
Pl_101866hypothetical protein PHYSODRAFT_391036

Sequence
3054 bases(100 bases per row)
AATAAGTTAATGTGAATAGTATCTTCCGATAGCAACTCAGAGTCAAAGTACAGCGCGTGCCAACGTTGACGAATCGGAGAGATCACTTTGTTCACAAAGA
AGTCCTGTGCCGCCTTGGTCTCATTTAATGGGATAGAACCTTGCAACAACGAACTGCTCAGTCTACATAATACACAACTTATTAGTAAATCGATCTCAGT
ACGCATCAATACAGCTACGATTACTTTTCGTAGTTCACGTAGAGTTGAAGATCATGCGGGTCTATCAGCATACCACACCACGATATGCACCCCTCCTGTC
TTGGCGTTCTAGATTCGTCAGCCTTTTCTCCTTCATTGCCGACCTCGAAATTTACTTGACTCTTGGCAACATTTACGAAACATCCATATTCCTCATTGCC
CTCATGCATCACCCCAAAGAATCGTTGTGCTCTCTTCAAATCCGTCGTAATGTACATGAAGTCGTCAGTATATCGAAACAGCTCTTCATGCTGGCAACAG
GAAACAGGTACAAGTGCTGGATCACATACTTCCGGCAAACGCTTACGAAGTACTCGCCTCTCAAAATGGGCGTAATACATGTTGCACAATGTCGTGGAAA
GCACGGAACCTTGAGGGATACCGCACCACTGCACGTAATCGTGACCTTCAAGTTGGACGACATTCGCAGATAAGTGTTCCTTCAACAACTGGAGAGCTTT
CGTTTTAGTCAGGTAGTCATAGAGCACACCATCCACAAACATTGAGTTTTTCTTCTTAGACAGGACTGCAAGCTCGTCGAAACCCAACAATTCACCGGAT
GGATATGCAGGACGCTCCAGCTTGAAGAAAAATGAAGACGAAGATAGTGATTCCTCATTCTCTGTAGAGATCGGGGCAACTTGATGGCCAACCCAATGCT
TGCGGATAAGGTATTCATCTTCTTGTATTGCCTTCTTGAGCATCTGATAGAGCTTCCGAGGTCGAATCGTATCAAAGCAGCGCTCAACGTCTACAGTAAC
GCAATAAGCCATTGGAGTGTCTCCGGATGCACGTCGCTCTGCGCAGCGAGTACATGATGCAATTTGACGAAAAAGAGGCTTGAGTCGCTTGTATATTTCG
TCAATGTTTCGCACTGATGCTCCAAGGAGACGTTTAGGTTGTCGATCCATTTCAAAAGTCAAGACTCGATGAACGACTTCCATGGTTCTGTTCACTGAGA
CCATCTTGTGGTCAACGGCTGTGGATAGATTCATAAGTGGACGAATTCCAGTAGCTTTGGGTAGCAACCGTAATCGAGAGGTTGCTAACTGTCGTTCTTC
AGAACTCTTTCTGGAAGGCTGCAAAATACCTCCCTCGAGATCTTCGAGAGCAAGAGTGCTGCAGATTGATAGAGTGTATTAGAACTCAGCGGTGCAAGAT
TTACACAATATGTACGTCTACCTGATCACATTCCAGACTGGGCGTTGATAGTACGCGATTTCATTCGCCATTCCCTCTGCTTCAGTAATAAAAAACAAGT
TTCGCAGCAACGGGAAAACTAGGACTGATATTACCCACCACAGTAAGTCCTCGAAGAGCCGATGTCGTTTGACTCGTTCGTTTGGTGGGCTAACATCGCC
AACATTAGATATAAATCGCAAAAGAAAAAAGTGCCGTACCAGTATGAAGTACTCGAATTCACGTTCATCCATTTCACAGTCGTAACTTGAAACTCGTGAA
CACACTAAACAAGACACAGTGAACACTTATTACTAAAAATTCAAGCAGTATTCTCGCATCCGCTCGAAATGCAAGGGCACTTACTTTTTTCAGCGAGAAA
ACGTCGAATTTCCGAGAAAAAATAAGTTTGCGCAGCATCGATTTCACGCAGTTCCAATTTTTCTTGGTGTTGCTGTCGCCCCACAGTTCTTTGGGTACGA
CACCAGCAACAAGTTTACGAACCAGTCTATAGATCTTTTTCTTGGGAGTCGCAAACACCAGCAAATTCTTAATATCATCCTTGTGTTGCTGCAGCTTTGT
CAGATCTGACACACCGCGAGTGCTACGCTCCTTTCCAGTGCTAGCATCTGCGTTCCTTGTTTTTTTACCAATGTGCGTAGAGTCTCCGTGGCCATTATCC
GATGATCTAGTTGAAGCATGTGACAGCATTTCAATTGCTTCCTCTCTACGCTTGCGCTTACGATCGAAATTTGGTGCCTCGGCTCCATCTTGGCTCAAAT
ACCCATCATCCAGTGCTTTGCGTACAATTGGTAGGAGCATAGGTTGTGAAGATGCCTTTGCATTAGCAGCCCTCTCTGCAATTTTATGATTAATGCTTGG
GTGATCCGTCATGAACTTGCGGAAGTCCTCGTTCACTGGGATCAACTTCTTGGCGAGCTCTTCGACTTGGAACATTTTGAACCTCGATACCATAGTCTGT
ATCGTTGGAATAAGATTAACCAATCGCTTTGACAAGCGCTTTTGATCTGCACCATCGGGGAAAATCGCTCGAAGTACTCGTGAAGCCTCAGTCCGACTAA
TCGGGTCGCCTGTCTTGGACGCCTTGACCAGCATATGCGAACTCGCATACACACGATTCTTTCGAGAATAGCGCGCATACATCACATGATTAATGGACAC
TTCCCGCTTCAGCGAATCAACAGAACCATCAATTGCTTGAGGCTTTTGTTGACGCATGCTTTTTCCAGCAAGCTAGCAAAAAAACAAGCAACACCACATA
TCATTAGTCTCAAATACAACATTTCTGGTTCAGTAAATGAATACCTGCATGTACGAGTCTGGAGCTTCCTTCAATTGAACAAAAATGGTGTAATTCAGCA
ACAAATGTGTCATGAGATCGTCCCCCATGAGTTGGTGCAAAGATTTCCACGGTGGTTTCTTCAATACATCCACCAATGTATTCGGGTAGTAGCAAATGAC
CCCGTTCGACTGCGTTACTCGATGTCCCGCAGCACCTGGTGCAACCTCTCGATACCCAAGCGTCAGAATATTTGCGTCCTCCCAATTCATTGCTCGCTTG
CGTGCTAGAAGTCGCTCAATCACATGATGCACCAGTTCGGTCTGTCGCCACACC