Description :
From Genome Similarity Track
Location :
Scaffold_943:7482- 9750
Sequence
2268 bases(100 bases per row)
GTAAAGCGGCACTGGTCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAGCTCGTGATTCAACCAGCCACGCAGGTGGATCATCACTTT
CTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGA
TCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTT
CCCATCCGGGTAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCAC
TTGTACCGTCGGGATCGGGATCTGGATCCGGCATTTGGGCTCTTTCTTATGAGCGACCCTAGTCAGCATCTCATCCATCTTAGCTCGAGGTGTGATGCTC
GCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTT
GTAACCCGGCCGACTTGAACAGCCAGGCTAACGTAGAGTGTCGGGTCAGGATTCGGATTGATCTTCCCACCACACAGGGTTGTAATTCAGAATTCAGCAC
GCGCCAAGAGCCGCGAGTATTCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGCAGGTGACTGGATGACAGATCCCC
TCATGTTCTTGTACAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATAACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGT
CGCAATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGA
TCCTCTTTCCTTTGGTCCCGGGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCAGGAC
CAAGGCTTGTTGGACTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAGTCC
TCGATGAACCGACTGTAGTAGTTCAAGAAGGATTGCATCGCCCGTAACGACTGTGGAAAGGACAAGTCTGCTAACGAAGACAGGTCCTTAGGATTCGCCT
CCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGT
CTCTAGTAGGGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTC
CCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGGTGAATCCATAG
AGGGCGTTATCGATCAGGCGTTGGGAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGCTCCACTCGAACAGGCCAAACAATGTGATGAATGCGG
ATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACACTACCAGAGTACTTTATCCAAATCTTCCAATAGCTC
ATTGATTAGAGGCATGGGATACGGGTCAGGCCGTTAACTAGCCGGTAATCAATACACAGACGTATATCCACCCCGTTATTCTTGACGATGATTACCACCG
GAGATGCCCACGGGGACGTTGAGAAACTGATGATTTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCG
CACCCTTTGAGCGATCGGTTTTGCGTCGTCGACATCGATGTTACATTTGACTCCGCGGGCAGCGGGCTATAATGCATTACCTTTACCAATCAGCAGATGT
CAGCTTTCCCAGATCTTCTGACGTAACCGATTCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGATGTCGTCAATCGTGACCTCCTCTGTGGTCA
GTGGTACCTTCGGGATCACCGCCATGCCTTCACCGAGATCCTCGGCGTGTAGATCCCCGACTTCATGG