Description :
From Genome Similarity Track
Location :
contig_57:7482- 8719
Transcript NameFunction/comments
g10933.t1hypothetical protein

Sequence
1237 bases(100 bases per row)
ACGTTGTTCGATGCACCACAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACA
GACCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGT
AAGCATGCACGGCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGTGGGCTCAAACGCTAGTTTGAGCTCCTCCTT
GAAATCCTCGTACGTGTTGAAGCACGTAGAGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCGGCCAAGACATGACCTGGCGAACGCAACC
TTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTA
CGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAAC
ACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCC
GACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTAGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCCGCCCCGCGTT
CGTATTCCATACAACGTGTCAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGATCTGCTTAGACCCACGACTTAAGCTTACACGTGTG
CGCACGCGTATGAGGAAGCGTAGGTGTATTTAACTTAATTTCAGTATACTTGTATCCGCAAGTATACTTAAACTAAGACAAGGGAACCGAACGATAGCTT
TGGTGCCAAACGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTATATTGAGAGGTTTTGCCATCGGATGGCTGGCAGAACCCCT
ATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCACATGCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGATCAACCTGAAT
GTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG