Description :
From Genome Similarity Track
Location :
Scaffold_3809:748- 2020
Sequence
1272 bases(100 bases per row)
CTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCA
GCTGAAGCTTCCTGTAGAACCACGTGAATAATCGACTGGATCTAGGGTCCTGTTACCTGGATCTAGCGATGTCTTGTTCACAAATGCCATAAATGGCAGT
AACCTAAAAAGCTCGGGCTCGCTAACGGAAATCCAAAACCCGGCGAGCGTCCCTTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCT
TGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTCCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCA
ATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTG
ACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGATTGTCTCCTGTTTTTGGCCCTTG
AATTCTTTGAAACACAATGGAGAAACAAACTGCAGCCGTAATTTTTCCGGGTTCGGATTCCGAGCCGTTAGAATCCTGATTTCATTTCCTGAATTCGGGC
GCCGTGACTGGTGGACCCCCTGAGCGAGCGGGGCCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTT
TCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTC
GATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCC
AACGGGGATTCATCAGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCCG
GCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCTTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGC
TTGATCTCTCATGAGGGCGGACTTGACTTTGCTGATCCATGTTCTCGATCGGTCCTCATCTTGATCCTTGCC