Description :
From Genome Similarity Track
Location :
Scaffold_3:74795- 75815
Transcript NameFunction/comments
Physo_329063Hypothetical protein

Sequence
1020 bases(100 bases per row)
ACACGGAAAACTGAAGCGCGGAACCCAAACCAGCAAATTAGCGGCGCCCAAACCACGGCCAAGTAAGCATGCCGCCGACGAGCACGGGCCAAGTCCCCGA
GCTCCACTCCAGCTCACCGGCAAGCAAGACGGCTGCGCTCACACGTCGCGCGCCTCCGTACCGCCGCCGCCATCGCCTACAGGAGCTCGTCGCTCGGCGG
GCGTTCACGACGGCGCCCGGTTCCTCGGGATTTGTTAAACGCAAGTGACAGTCAGCAAACTTCAGAAAACGCCTCAGCGCGTTAAAATCGCGGCATTGCT
TCTCTGACATGGAGGAAAAAGATTCCATGCGCCGCCTACAGGGGAAACCAAAAAGCAGCAGCGATGGCAGCGGCATTCGTCGTGCTAATAGATGTAGTGC
AGCCGTCTCAGACAGTGTCTGCACTGCACTCGGCTCCGGTCCGGGAAAAGTGGCATCATCGGCAAAGGTGTCGTGGTTGAGGTGCTGCCGAACGACTGCT
TGCAGTTTGGGCCGCCCCTCCCGTCGTCTCTCGCCATCGGGGCGGCAAGTTCAACGATGGGGGGCACCACGCTCTTCAGCCAGCGAGCGCCCCGCGCGAG
GCTCGGCATGTGCTCCGGCAGATGGCCGTGGTGGCGGGCAGCCTCACTGGGAGCGGGTCGGCTTGTCCTGCTTGGCGTGCTGCACGCTCCATACAGGCCC
TGGGTCTTCGCCAACGGTCTCCACAGTCCCGTTCAACGGCGACCTGCAGCTGGTTTCGGTGCTGACTCCGCTGTTTACCTGCCGCGAAGCTGCCGGCGTT
ATCATCAGCCGACACGGTGCGCGTGTCATGCATAGCCGCAAAGCAAAGCTTTGCCGAGCTCCGCGCTCCGCTGAGCTGAGAGCCTTGCCTGCCTTCCGGG
TGCTGAGCTGCCAGTGCAGCAGAGCGCAAAGCTCAACGCTGAATGTGCCGATTGAAGCTGCCGTTGAAGCTGCGGCAACCCTCCTGGTGGTGGGCAGCAT
CCCGCTGGCTACTTCGAAGG