Description :
From Genome Similarity Track
Location :
contig_122:74790- 76666
Transcript NameFunction/comments
g13997.t1hypothetical protein
g13998.t1OWZ10871.1 Major Intrinsic Protein [Phytophthora megakarya

Sequence
1876 bases(100 bases per row)
TCAGGTCGCTGCCCTTGAGGTGGCGGGCATTGCCGGCGCTGGTGAAGCTGGTGCACGCGATGAACGTGGCAACGAAGAGGGTGAGGAAGACGCTGAACCG
CATGACTGTTTGTCTCGACGGAACTCCGAGGTACGAAGAGAGCTCCTGAGTGACTGGGAGCTGGGAGATTCCGAAATGGGAAGCGCCTACCAACCTTGTG
CTGGTCCAAAAACTTGAGAACAGTAACGTTGAGCTGCGTTCATGTAAGAGAGACGGTCGATTACTCGCCTGGGCAAGCTTTTCTAATGCCCGTAAACCAT
TTCATCTCCGCCAGACTGCCTGCGCTCGTCGGTGTATACATGTGCTGTGTACCGGACTGTAGCTCGTGTGGTCTTCTGATCGATGCTTTCTCTAACAAAT
CAATAACCCCGTCTCCGCTGTAATCACCAGGCTCGGAATGCATGGCCAAACTACCGTGGTCGAGTACCTGAACTGTCAAACCCGTACTAAGCTCTCCTGC
TCGAAAATCGATCCACCGACTTTACTTTAAGCAGACTTGATTTCGTGGACAGATTGAGAGCGGGAATATACCAAACCTGCGAAAACAAATGCCACATGGC
AACAAATAAGGCCTATTTTCCGCTCCAATCAAGTTTCGCAGGATCTCGATTTGATATTTTTGGAAAAAAAATCCCTGGGAGGAAAATGGTAGTTTTGGAC
TAGTAACACTGGACGCTGAAAGTACTGGTGATCGTTGTTTGCTTCAACGCGTCCTCTACCTTGCAATCTTCTCGAACGCGAATCTGAAGCGTGCGAAGAC
CCCTTTATAGGCTTCTGTTAGATCGGGATGTTTTTTTTGCAGCCAGGGACCAGCGCCAAAGGTGCGCAACGCGGCGGGTCGCAATGGACTAGCGCCATTC
TCCAACAACCCAAGCTGGCAGGCAAGGCCTAAATCCTCTCAGACTGCGATGGCAATGATTTACCCGTTCTCCTCTTGTGATTCTGAATAGCTAGCTCCCT
TCGACTCTCTTTGGAAGTGTATCAACCGCACACCGAAAGCCCTCAATGCTCGACGTGCGCCTCGGACTGCTACAATACGGTATCGCCGACGTCGTGGACG
AGGACGGCGCAATCGTCGCTCATCGCGTGCAGGTGGCGCTCGTGCTGCCTCCGCGACTCCGGAGCTGGCTCTCCGCAGTGTCCCGATATCTGCAATCCAG
ATACTTGTACTCCTGTTAAAAACTCTCGTGGCCTTGGTGGAGGCTTCGTCCGTTGGTAGGACTGAAGAAAGACATATTCACACAATTGTATTTTACTGTC
GCGGTAGCTACGAAAGCACGTCGCTGACGCTTTCGGTCTCGTCGTCGTTGTGCTGCAGCTGCACGATGAAGAAGTAGGACCCCGCGCCCATGACGCCACC
CACGAGAGGACCGACGATAGGGATCCAGAAGTAGTGCGAGTGCGAGGAGAAGACCTTGGGGCCGTAGCCGGCCAGGAGGGTGAACAGGCGAGGGCCGAAG
TCGCGCGCCGGGTTCAACGCGTAGCCAGTGTTCATGCCGAGCGCCATACCGAGGCCCATGAAGAGCAGAGCGAACGCGAACGGAGTACCGACGGGACCCG
CGCCACGGTTGCGCTCGTCCGTGATGGCGAAAATGGCCATGAGAAGGACTGCGGTCCCCAATGTCTCCGAGTAGAAGGCGGTGACGTTGGAGATGCTGTC
ACGCGGGTACGTGGCGAAGTTGCCTTGTGTGGTCATGCTGTCCGGGTCTTCGAGCATCAGACGCTGGTAGTGAAGCACGAAAACGAGAGCCGACGCACAG
AACGCTCCCATTGTCTGAGCTAGAACGTAACCAGGCACTTTCCACCACGGAAGACGCCCGAACACAGCGTGGGTGA