Description :
From Genome Similarity Track
Location :
contig_57:7479- 8714
Transcript NameFunction/comments
g8885.t1hypothetical protein

Sequence
1235 bases(100 bases per row)
GTTGTTCGATGCACCACAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGA
CCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAA
GCATGCACGGCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGTGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGA
AATCCTCGTACGTGTTGAAGCACGTAGAGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCGGCCAAGACATGACCTGGCGAACGCAACCTT
CGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACG
TGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGCTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACAC
CGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGA
CAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTAGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCCGCCCCGCGTTCG
TATTCCATACAACGTGTCAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGATCTGCTTAGACCCACGACTTAAGCTTACACGTGTGCG
CACGCGTATGAGGAAGCGTAGGTGTATTTAACTTAATTTCAGTATACTTGTATCCGCAAGTATACTTAAACTAAGACAAGGGAACCGAACGATAGCTTTG
GTGCCAAACGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTATATTGAGAGGTTTTGCCATCGGATGGCTGGCAGAACCCCTAT
CTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCACATGCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGATCAACCTGAATGT
ATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG