Description :
From Genome Similarity Track
Location :
Scaffold_40:747868- 750557
Transcript NameFunction/comments
Phyin_T30-4PITG_15705Dihydrolipoamide succinyltransferase%2C putative
Phyin_T30-4PITG_15706Putative uncharacterized protein
Phyin_T30-4PITG_15707MtN3-like protein

Sequence
2689 bases(100 bases per row)
TAACGGTAGGCTCGCCATTGTTCCAGATCGTCAAGGGCGCTGCGGGCGCCGAGAGCGCGCAGGAGACCAAGCCGGAGACCAAGACGGAAGCCGCGCCGGC
TGCCGCAGCTCCGTCCGGCGAGGAGACTACCGTGCCTGTGCCGTCCATGGGTGACTCCATCTCGGAAGGAACCATCGTGGAGTGGATCAAGAAGTCCGGA
GACTATGTGGCTGAGGACGAAGTCGTCGTCGTGCTCGAGACAGACAAGGTGAGCGTGGACGTCCGTGCTCCCAAGGCCGGCACCATCACCAAGACGCTGG
CTGATGTAGACCAGACGGTGGAGATCGGCGTGCCGCTCTTCTCTATGGTGTTCGGTGGTGAGGCGCCCGCCTCTTCGCCCGTGCCGGAAGCTCCGGCTTC
TACTCCCACGCCGGCACCGGCATCGACGCCGGCACCTGCCGCCACGCCCGAACCGGCTGCCGGCACTAACCCGCTACTAGCCACGCCTGAGCGCGCGTCT
CGTCGCGAGAAGATGAGCCGCATGCGTCTGCGCACAGCCGAGCGCCTGAAAGAGTCGCAAAACACGGCGGCCAGCCTCACGACGTTCCAGGAGGTCGACA
TGTCTAAGCTTATGGGTCTACGTAAGCAATACAAGGACGCGTTCGAGGCCAAACACGGCGTTAAGCTGGGTTTCATGTCTGCTTTCGTTAAAGCCAGTGC
GTCGGCACTACTTGAGGTGCCCGGCGTCAACGCTATGATCGACGACGAGCACCAGGAGATCGTTTACCGTGACTACGTTGACATGAGTGTTGCTGTGTCG
ACCCCTAAGGGTCTAGTGACGCCTGTGTTGAAGAACACCGAGTCTATGAGCTTCGCTGATGTGGAAAAGGGTCTGGCCGAGCTCGCGGCTCGCGCGCGTG
ACGGCAAACTGACGCTCGAGGAGATGACCGGCGGCAACTTTACCATCTCGAACGGCGGCGTCTTCGGCTCGCTTATGGGCACGCCGATCATTAACCTGCC
GCAGTCCGGCATCCTCGGCATGCACGGCACCAAAATGCGACCGGTCGTGGTGGACGGAGAGGTCGTCGCGCGGCCCATGATGTACCTGGCGCTCACGTAC
GACCACCGCCTCATTGACGGCCGTGAGGGCGTCACGTGCCTTAAGGCCATTGCCGACAAGATCGAGAACCCGGAGCGTCTGTTGCTCGACATTTAAGTTG
CAGGAGGAAGTGCAATTGGCCAAATTTGCAGAGAAAGAATAAAATGTGTTTTCTTTCAAGCAACTTAAGGATTTAAAAAATTACTTACGAAAGAAATCGT
CGACGACGTGGGGAATGCTCGGGTATCCTGTACACCAACCTGGGAAATGCGCCTTGTGGGCTTGAGCTTTCGTGATGAAGACGTTGCAGAAGGCAGCGAG
TAGTTTTTTGCGTGTTTGCACACCTGTAGCTAGTTTGATCAACGCGCGCGGCTGGGACATTGAGTGGATGATGAAGCTCATAAATTCGCTGCAATATTGA
CACCTGTATCCGTCTTCATGTTGCCGTTGTGCATACATCCAGACCTTGTAGCGAAGGTTGGCAAACTCGTTGAAGCGCCGTTCAAGCTGGTAATCTGGTT
GATCGGAGACGACGGTAGACTTGATCGTTGGGATGTGCGAAGTTTTATGTGTTAGGAACACGTCGATGCGGTAGAACACGACGCCGTCGCGCTCTACCGT
GTCGTTGATCTCAATGTGGTCGATTGTGTCTAGGAATGACGGCGATAAGAGCTCGGAACACCGCGTTGGGAAGATTTCCAGTTTCTGAAGTTGCTGCAGT
GATGGCGTGGCGGTTGTGACGTTATACTTGGTGCACATGTTTGATACGTGGCGAATATGATAATGGCTCGATAGCTTCGGCCCTCAAGTCCAAGGGCATT
CACTTTTGTGGTGCATGGACACCTGTCACAGATCGACTTGTCTTTTACCAAACGTCCCTTACAGGTGCATGTACCGTGCGTCATATCAAGTTTTCGTCAT
GGCGAGAGTCAGAAAGTCACTGAGGCTTGAGAGCACAAAGTATGAATTCTTGCCACCATGCCATTTTTCTCAAACTCAGACAAGTCGTGGCATCTGTCTA
GCCTCTGCGATAGAAGTATGTTCGACAAGTTGTGTCCCTGGCTCAGCCTTGGGTATCTTTCGATGACGAAGAGTGTGAATCACACTGCTTGGACGACGCC
GTGCAGAGACCGTGGGCTTACCGTGTACGACCACGGGATTGTTCCGATGATCTCACTGACTCTGTGAGACAAGGCTTGCCACGTCTTCGCGTGGACTTGG
TGCGAACCGGGAACATCCTACAACTGAGCGTGCCAAACTTTCGAGCAAAACAGACGAGCTCATAAGAGGCGACACGGCTTGCTGTCTTACCTCCGACACA
CAAATACCCTGTCTACTTTCATTCTTCATTTGGCCGTGTGCCTCCCTCTATCTAATCTCCAACACAGCCATGTCTGACACCGCAGTATTGGTATTTCGCG
TCCTCGCCGGTATGGCGACAATCTGCATGGTCTCCAGTCCATCGCTGCTCATGTACCGCATCCATCAACAGAAACACGTCGGTGTCGCATCTGTCACACC
CCTTGCGGCACTTCTAGCAAATTCCCACGTCTGGTACGCACACATCCCCTTGAACTTCACCAACTTGTCAATATTTTTTACAAACCTTT