Description :
From Genome Similarity Track
Location :
contig_43:74786- 76664
Transcript NameFunction/comments
g7453.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
TGGAAGTACGGGAACTGGAGCCACATCATCACTAGCAGCTTCACGTGGTAAAACAGCGGGAGCCACGCGATCTCTCGTCCGATCGCTGCGATCAAGTAGT
CCGCAGTGACAGCCACGCTGAAGTAGGCGAGCCACCACTCGTAGCGCCGCGTCCGCTTTTCGCCTAGCACTCCGATCGTGACGTAGGCGGGGAAACCAAA
GCCCATCAGCGAGCAGCCACGAGAGGCCACAAAGCCTGGCGTGAACATGAAGAGGAGTCCGAAGAGCGCAGGACCCTGCGACCACAGGTCCTTGGCCAAG
TGCACGTGCTTCTCCGGCACCACGCGGAGCGACACCAGCAAGCGCATCAAGACGTTTGCCTTCTCTTCGCCTTCTGTGTTGATCGGCTCTCGCTCGTGAA
GTCGATTGGCGTAGGGACTGATAAGCGGACTCAGCAGCGTGTAGAGCGCAATGTCGCCGCGCGTGAACGGAGAGTGCATCCACACGAGGAAGATGTTGCA
GAAGTGGAGCGGCACAGTGAAGAAGGACGTCACAAACGCCGGCAGGAAGAGCGTCACCATGCCGATCAAGCACGCTGTGAGTGACCAGATCACCCAGTAC
TTCAAGCAGGCCTCGTACGCGCGCCACTCGTAGTCCGGGATGCCAATCTTCTCGAACTTCTTGATCAGTTCACTGGTCGGTCCTGGTCTTGACGCCGGCG
GAGTGGCTTTGACGTGTTTCGGGTACAGCCTCTTCTGTCTGATGACCCCGATTGAGTGCAGCAACGGGTACCCCACAGACAGCAGTCCAAAGAGTGTTTC
ACTGCTCAACACGTCCGTCGTAGGCTCTGGTAGCCAATCCAGCGCCTCATAGCTCAGCGCAAAGAACAGCACGTGGGGCAGGAGAATGGCCACTATGCGC
CACTTGGCGCTTAGACTCGCGACGAAAGCTCTGTACCGGAGCTCCAGCAGCCTCCGCGTCCTTACGTACTGCAGTCTGGCCTTGTGCACATACCCCTGGC
GGATGCAGACGGCCACTAAAAGCCCCGAGAGCGCCAGAATGGCCTGGTGCACAGGGTCCATCCTGCCACGTAGTCGGCCCCCATCTTGGCCACCGCAATG
ACATGAGGCAGCGCCGCCTCGCCCAATAAAGCCAGCAATTGAACCAAGGGCACAGCCACCAGTAGCAGGAAGGTTCCCCATAATTGCAGACACTGGAACG
TGGCCACGACGGCGTCTTCCAGTGCGAAGCCGATGGCGCTCCAGTCCGGACTCTGCGCGAAGACTTGAGCGACGTGGGACGCGTTGAATGGACTGGAGAA
CAGGTTAAGAGGCAGGTACTGGTCCAACAGCCCCTTCGTGTAGGGCAGCGCGTCCTGCTAAATCCACGAATTAAGGGAGAGACGTAGGAGTTAAGGGAAT
GTTGCAGGAATTACGAGATAAAGAGAGACTGAGACGCGTACAGAGAGGATGGGCACGGGAGCTTCAAGTGAGGCAGTTGCAAGAGGATCTTCTTGCTGGC
CATTCAGCTGGACGAAGAGCAGCGGCCCTAGAATCAGCGTCACGGGGAGCAGCACGCGGCGCAGCATCGTGGCGACGAGTCGTCGGTTTGAATATTGGAT
ATGTCACAGGATAAGGTCATTATAGGGAGGGGATATATGTGACGTGTGAACACTTTTGGATTGTATGTGGACGAGTCTCACACGTCGCAGATTTGATAAA
CGGAGACTTCAACAGTATTCAGGATCCAGGATTGGTGTTGAGCGTAGGATAGCGCTAGGTTGGCATTCACAGTGGAATCAATACAACCTTAAGAGCTCCC
AAGCATCTTCAAACTCAACAAGCCGTAGGAAAGTGGGTGGTATATCGTTCGATTCGACCATCGAAAGGCAAGTTCCGA