Description :
From Genome Similarity Track
Location :
contig_75:74783- 76501
Transcript NameFunction/comments
g10001.t1hypothetical protein PHYSODRAFT_505512

Sequence
1718 bases(100 bases per row)
TCTGCTTCTCCTCCAGACGCCGGCGACGTCGAGAAGCGCCCCCCAGAAGACTCAAGCCAGCCTTCAAGCGGCGAGTCTCAGGCCATCATCCTGCGTCAGC
CTGATGGTGACGACAGCGCCGAGAACGCCCCCGAGCGAAAATGCTGGTGGCAGTGGCGTCAGCCCCATCCGATGGGCGAGGGTGTCGTGTTGCCTTCCTT
CTCGCGACCACGCCACGTGCGGATGGAAGACGTCGACGCGCTATTTTCAAGGGCGTCCTATCGCAAAACGATTCGTCCCGAGACTTTTGCTCCTCCTGAC
TCTTCGGCGCGCTGGACCTTGCCTTCCCTCCAGACACCGGCACCAAGACATACTTGGTGGGTTCCAGCCACGGTGGACGACACGCGCGGCGGCGGCTTCA
CGATGAATGGATATGGGGGCACTACAGCATTGATTGGCTTCGAAGAGATGAACGCGGACGACAATTCTGAATTCGAGCGTCTGTTTGACATGAATGCCCG
TCAGTACCTCCTGCAAGCGCGACAAGATCCGCTCCGGCTGGATGCCTTGACCTCCAGTCTGGACGACATTGGCACGCGACGTGAATTCGCCTCGATCCTG
ACTCACTTTCCTCCGGATCAACTCGCCTCGCGTGTCTTCCGCACTTCGATGTATTTGCGTCTTGTTCTGGGTGAACATCGTCGACTTCGGGCGCAGATTG
AGCGTGGTCAGGAAGCCGCGATTAAAGACGCTCTGGAGTTCAAGCGCATCAATGGTGACCTTCGTCGTGAATGGAAGTTCGTCTGCGCACACTGGCACCA
AGAGGTGACTTCTGCACTTGCCAAGGCCAACGAAATCAAGGCCTCTGACCAAGACGAAGTCCAGGCGTTGAAGTCTCGATACCAAGACCAAATCGACGCG
CTTGAGGCTGAGAAGTCCGAGTTGAAGGCCCGTGTCGACGACGCAGAGACTCAAGTTGGCATCCTGAAGAAGCGTCTGGACGATAGTACCATGGATCCTT
GGACGCTGTCCGCCTTCATGCAGAAGCACGCTGACGTCTCCGGCAACTGGGATCGGCTGCATGACTTGTTTGTGCACTGCGTGAATGGCTGCGTTCCTCC
GTCTGCTTGGGACACCGTCGTCAACATCACGGCTATGGATCAACGCAAGGCTCCAATTCCAACGTTTCCTGCGTCTCGTCTGGCTGTTCCAGTTCCCAAG
CCTCCGGTTTCGAATCCTGTCATTCTGGACTTAACCAGTCCATCTGGCATTCAGGAGTCCAAGCCGCATTCTGGTGACAAGTCTTCGCAGAAGTCGCCTA
CTCCAAAGTCACTCAAGAAGACCAAGTCTCCCAAAGTCCAGAGGCGACCATCGACTCATCACCCAGGCCGCGACTCAGTGCGCAAGGCCGGTGAGAAGAC
CACCATTTCCAAGGAGGCTGCATGCAAGATGCTTCCTGGGCGTGTCATCTGGAAAGAAGTGCGTCCTGACGTCCGGCAGATTATCCTGGCTGGAATCAAG
TATGAAACGGCAATGAGGCGTCTTGACCAAGACAAGCCGCACACGGGTTCTTTCGGCAACCGCAACTGGTCAAGATGTTGGTCAGCATGATGTACTGGCG
TCGTCTTGATTTGACCCCATGGGCCAGGTATGTGCCAACGACGTATTACAAGATGGCAGATGAGCGCCTGGATCGCAAGCTGCGCCGCGGGGAAGTGCCT
CCGTCTTGGGGTAACCTG