Description :
From Genome Similarity Track
Location :
contig_5:747815- 749258
Transcript NameFunction/comments
g1447.t1hypothetical protein F443_18978

Sequence
1443 bases(100 bases per row)
CTCCATCGCCGTTTATCTTCACGAGCAACTCAATCTTGCCTCCTGCAGACGATCGCGGCACCCACATGAGCAGCGATCCTCCACCGGAACCCGGCACATC
CAGAAGCCCTGGACGCCAGCGGTCGAGATACAGCGTTTGGTCCTGAAGAGCCTTCACCGTCGAGTTCCACGACATCGTCTCGCCGCTCGCCACGTCCACC
TCAGCTACCGTGTCACCGCCAGAGTGAATGACCACCGTCACATCTTCAGTGTCAGTGCTCTCGAACGTTATGTTCACCGAGCCATCCCCAGATTTACTCC
AAGTGCCGCAGCTGCCGTTGAAAGCCTGGTCTTCCGTTGTGAGCGCTAGCGCATCTGCCAAGGAGCCATCATCGATCTCTCCGACAAAGGACGTAGGTCC
GCAGATGGGTTGGATGAAGGTGGCCATCATGTCAGCGATACCAGTCGGATCGAGCGTGGCGATGACGTCCAGGCCCATGTCAGCCACCGACACAAGGTAG
TCTGACGTCGAGATCGCGTTTCCGTCATCGTCCACTGCTCCGTCAGCCAGGCCGTCCGTGATTGTGCTCATTACTGTGCGCGCAGTGTCTCGTACACTGA
AAGCATCGTCCGTGAGGTTGCGGATGCAGGTGTTGGTCACAGCGGGAATATCCTGAAGGAAGAGTCCGAGACGCTCAGAGCCTCTCGGATATTGCTGACG
GTGCTACTGGGGTCCTTGGTCTTGATACCAGCCACGAACTGCGTCACCTTGTGGATAATCGTCTGCAGCTTGGTGCCGCACGTTGTGCCCGCCGTTAGAA
CGTCTTGGAGCTGGGCGACGCTGTCCGTGTCGAGGTCTTGAACAGAGTCGTCAACGCCAATGTCGCTCATGAGCGCCAAGAACGTACTGGGGTCAAGCAG
CGATGCTCCATTCTCAACCACCTCCGTAACAATCTGGTTGACGGCAGCAACCACGTCAGCACTGAGCTCCAACGTGTCAGTAGACACCGGGAGTCCGAGG
CACGTGCAGACAGCCGCAGGCAGCTCGTTGATGACGAGATCGACTGGTTCACCACGCTCAGTAGCTGCTCGCTTTGCGTTGCGTTAGCCTGGAGCTCGTC
CACATAGCTCACAAGGGAGCTTGTGGCTGCGAAGAGCGACTGGCCGCACTTGACACCGAGCTGCAGGGCTTTACTGGCCTTGATGAACTCGCCGAAGACG
CCAGCCGTAGCGGCATTAAGTGCCACCGTAGCAACCGACGTGACCTTGTCCAGGACCTCGGAAGTGCAGTCCGAACTCTGTGGAATACACTCCGCGCCGC
ACTCAACAGGAAAGTTCAAAGGGCACTGCGCCCAGCATGATGCAATTCCATCAGACTCGTAGCCTATGGCGCAGGTCTCCGAAGACAGGTACGTCTTGCG
GTAGCAGGCGGAATCTGTCACATTGATCGGGCTCACCCAGTTG