Description :
From Genome Similarity Track
Location :
contig_23:747806- 753568
Transcript NameFunction/comments
g6468.t1hypothetical protein
g6469.t1RAW35223.1 Protein arginine N-methyltransferase 3 [Phytophthora cactorum
g6470.t1hypothetical protein

Sequence
5762 bases(100 bases per row)
ACGATAAAGGTGAAATAGCAAAGCAATCGCCTCGCTTCGAGTGCCAGACCCCACCCCACCCCGAGCAAGATCAGTTTGTACTCACAGGGGGGGGGGGTAA
TTTGTACTGGCTACGAAAAGTGCAAGGTTTTCTCATAATAAGGTCGAGATTAAATGTTTTAATATTTAATATTTAAAAAGTAGCCGCGTAAGTCTTAGGA
GTAAAACTGTACGGTAGCTTAAACTGGGACACGTGCTTCTTCGTGGTAAAAATCGTCTCAGTCCGTCAGTCGAACAAGCGCTTCTTGGGGCGCCATGGTG
CACAGCAGCAAGTATGACCTGCTCATCAAACTCCTGCTGATCGGGGACAGCGGTGCGTGTAGTCTCCGCCTCCTGTCGCCCTTCTGCCTGCCTTTAACGA
CCTTTGTGTTCCTCTTTCTGCCTCAGGCGTGGGGAAGAGCTGCGTGCTCCTGCGCTACTCGGACGACTCGTTCACGACTTCCTTTATCACCACCATCGGG
TGCGTCTTGACTGGGAGTTTGTATGCTCCAGTATAGCTGGGGACTGACGTTGTGCTGCAGCATCGACTTTAAGGTGAAGACTATCGACGTGGACGGCAAG
CGGATAAAGCTGCAGATCTGGGACACTGCGGGTCAGGAGCGCTTCCGGACGATCACGACGGGTGCGAGCTGGGTCTTACTTGGTATACCTATATTTTATC
ACGTGTCTGACTGGCGGTGTGGTATGTGGGCAGCGTATTACCGTGGCGCGATGGGAATTCTGCTGGTCTATGATGTGACTGACGACCATTCCTTCCAGAG
TGAGTTGGAAGTGCTATTTTATTGTGTCTATGTGGGAACTACAGTAACAGCTTTTGTTTGGTGGATTGTGTTGAAGATCTGACTTTGTGTTGTTTATCTG
TGGTGTCGGGCAGATATTCGTAACTGGATGACACAAATTCGACAGAATGCGTCCTCGAATGTGAACAAAATTCTCATCGGAAACAAGTGCGATGTGGATC
CGTCGGAGAGAGTACGTTGAAGGCTGTGATGTGATGTATGAATGTGCTGGTTCTGTGACTGATGTGCATTCTGGTGGTGCTGGCTGCTATCAGGCGGTAA
CGACGAAGCAGGGCCAGGACCTCGCGGACGAGTTCGGAATCAAGTTCTTCGAGACGAGCGCAAAGAGCAACAAGAACATCGACGAGGCCTTCCGCTCGAT
CGCTGTGGACATCCAGAAGCGGCTGGCGGAGAGCGAGCACGATAGATTAGACGTGGCGAACGGCAGCAAATTCCGCGTGGACGAGTCTCAGGAGCAAGCC
AAAGACAGCTGCTGCGCCTAGTTGTCTCTCGGTTGCCCTCCCTCTCGCTGTTGCTTGTCTTTCGTCTCGTTTATCCCGAGTGAGTGGTTGACACGCCTTA
CATGAGTCGACACGAAGTAGAGCTCAGCAGCGTGCAGGACGAGCAGCCAGCTACCGGATGCGAATAAGTCTATCATAAATCTCTTGCACTTACATCTTTC
AACTGGCAATGAGCAGGATTATCAGGTGATATCTAAAAGTGTAGCCATGTGTCACAGGCCAGTCGTTTTTGGTTGGCTGGCGGTGCATTTGCCAAATTGG
CGAGCGGACATGGCGGAGTGCGGCGACATCGTGGACGGCGGCGAGACGTGGGACGACTGGGTGGACGACGGCTCGTCCGCCAGCTTCGACTGCGTGTTCT
GCGCCGCCAAGTTCCCGGCGGAGGAGCCACTGCACGCGCATCTGCAGGACTCGCACGCGTTCTCGCTGCGCCGCGAGGTCTCGACGCGCAAACTGGATAC
GTACGGCACCATCCAGTTCGTCAACTTCCTGCGCTGGAGTACGCTGGACGGCGCCTCCGAGGAGCAGGTGAAGCAGACGCTGGCTACCGAGGGCAGTGCC
GCCTTCCAGAAGGACGAGTTCCTCAAGCCCGTGGTGGCCGACGACCCGCTACTCTACTGCCTCGAATGCGACAGCAGCGACGACGAGGACAATGAGGACA
ATGAGGACGAGGAGCAGAAGACCGACAAGGTGGCTGTCCCCAGTGCTGGAGATGAAGCTAGTGACCTTATTGCCAAGCTGAGACTGGAGAACCAGGAGCT
CAAGCAACAGATGACCAAGTACTCGAAACTCGTCCGCGACTTTGTGGTGGATGGCGAAAGCGCCGCGCCCGTTGAGGACGCTGCCGACAATGACACGTAC
TACTTTGACTCGTACTCGCACGTGGGCATCCACCGCGAGATGATCACGGACAGAATCCGCACGGACGGCTACCGCAACGCCATCATCAACAACCCGGAGG
TGTTCAAGGGCAAGGTGGTGCTGGACGTTGGCTGCGGGACGGGCATTCTGAGCATGTTCGCTGCACAGGCCGGCGCTGCTAAGGTAATTGGCATTGACCG
CAGCGAAATGGGCGACGTGGCTCGCGAGATCGTGGCGGCCAACGGATTCAGCGACGTCATTACGATTCTCCGCGGCAAGGTGGAGGACATGGAGCTGCCG
GTGGACAAGGTGGACATTATCGTCTCGGAGTGGATGGGTTACTGTCTCCTGTACGAATCGATGCTGGACACTGTGCTCTTCGCGCGCGACAAGTGGCTTG
CCCCGGGTGGACACCTGTTCCCGGACAAGTGTTCGATGTTCATCCAGGGCATGGAGGACTCGACGAATCGCTTTGCCTTCTGGGACGACGTGTACGGCTT
CAATATGCAGCCCATCAAGTCCAAGATCTCCATTCGCGACGCGTTTGTGGAGGACGTTCTGCCGAGCGACATCATCACGAGCCGCGAGTTGCTGCAGAAG
ATCGACATTGATCTCGTCACGTACGATGAGCTGGACTTCCACTCGACTTTCACGTTGTCTGCAACGAAGGACGCGACAATGCACGGATTCGTGTCCAGCT
TCGACATTGGTTTCGAGCGTGACTGCCCGCGTCCTGAGTACTTTACGACGGGAGCCGAGGGCACGCCGACACACTGGCACCAGGTCTTCTTCCACATCCC
GAAGCCTTTCACGGTCAAGAAGGGAGACGCCGTTGAAGGCAAGTGGTGGGTGCGGCGAAACGCCGAGAACCCGCGCTTCCTCGACGTTGAGATCCAGTGG
AAGCAGACGGCCGAGGGCGAGTTCCTTGTTCAGCGCTATCGCATTCACTAGAGTTTTTAGCGCACAGACGCTGTAACATTTGCTTTGAATTTTTTCAGCT
TATTTTTTGTGCTTTGTGCTTTCAGCCACAGCGTAAGCACTTTTTGGTGGAAGAAACCTCTTCCTTTGGCTCTATGAATGCAGCTTGACTTGGCTAATGA
CGTCCTTCACCAGAACAGACATCGCCTGCACCTTCTCGAATTCCTCGCCAGTGGGCGAGATCATGGCCAAGCACTTGAGCAAGAGGTAGTGAGTGGAAGT
GAGCGATGGCGTGAGATCGAGGTTTTCTACCAGGGGGTCTGACACGAGAGGTGGCTGAGCATCATTGATCACCCACGAAAACACGTCCGCACGCAGCATA
CTCATCACCACAGCGTACTCCGCCTCGGTCTTCATTCGCCGCAGAATAAGCGAAAGTCGAGCTCGGGCAATGGCTCCTAGCTTGAGTACCAGGCGCTCCG
GTTTCTGCATCTTCTCGATTGCTAGGTCGGCCCGTTCGTCCCTCCCGGACTGGTACAGGAACAACACGTACTCTTCACGGATTACATCTAATGGCAATCC
GAACGCTTCTGTAAGCGCGAACCCCAATGTTTCGTCATGTCGGAGGAGTTCCTTCAAAAACCTGGTGCGATCTCGGTTGATCCATTTTAACTCTTCTTCA
CTCGGCTGGGCCAGTGCTGGTGTTATTAGGAAGCTGTCGGGGCGGCACAAGCATCGTCCACTGTTCGAGAACAGCTTCACAATCGAGATTGGCGTCACCG
CCGTTGCAGCAAAGGAATCGAGCAGCATAATCAAACTAATGTGGTCTGCGATCTGCGACGTCGAGATCATATCGAACTTGAAGCTCTGCAACGTTAACAT
GAGCGAAGACGTATCATGAGAAGGTGGCCATCGCTGCCTGAAGATCAAGTGAAGATTCTTCACACGACACCGCCACTTGACTGACTGCGTCAAGCTATCC
ATCTTGAATGCAGTGATACGTAGTACATCGTCATCATCGTCAGATTCAACATCTGCATCACTTGTTTCATCATCGTAGTCCTTTTCAACATCACCATAAG
CTGTTTCAGTTGATCGGGTCGCTGAGATAGCCTTTACAGCCGCCGATAACGTGACAAGAAGGCTCCGGATAATACCGAAAAAGCGGCGGGCAACTTGCGG
CTGGAGGCCACGTTGCGGCTTCTTACCAGCGGCACTTTCCTCCCAAAATGTGATTAAAGTCACCACGTGCACACGGATGTATCGCTCCCAAATATAAGCC
GTCATGGCCGCTTTCACTTGAAACGAATGCACGCAATCAAGCTCGAGCAGCGCATTTTCGAGCTGGCGCATATCTGATCGCTCCGCATTCCAAGCGGTGC
AGAGAATTCCTACCCGAAAGCAACATAGAGAATCTTTGTCCAAAAACTGTGGATACGCGCGCAGTACAGCTGCCCAATCCTTCATCTGCGCAGCCTTTCG
GCAGTTCTCCATTGTCGCGACCCAGCCATCTGTGCCATCACTGCTCACATTGGCCTCGACACGATCCCCAGGTATTGCACTGCAGCATCATCTTCGCCGG
CCTCGTGGCCATCATTAATTTGCATGACAGCTAGACTCCGCATAATCTCATCCACGTGCTCAACTGCGTCGACAGATAACCGACCAACTTTCCCAAGACG
CAACGACATGTGAACCGTTTTCGCGATGCAATCTTGCAAAATGATCCAGCGTGTCCCGCTACCCGTGCTGCTGTACTTTCCGAACGTGTCTTCTTCAGCA
TGCTTCGCTGACTGTTTCTCTCCCCACCCACAGTGTTCACTCAGCACGAAAGCATGGAAAAGCTTTGGCGTCTTCCAGCACGAGTTAAAGATTTCTGCCA
GCGAGCGGGGACAATCGCGCAAGCGGCGCAGATAACTTTCTGCAGACACAAATGATGCCTCAGCATTGTCTTCCCCCTCTTGCTCTATTGCCGTCTCCAC
ATCTCCGATGACGAAGTACGGGTCTAGCCAACGCTGAAGAGATGAAGACATTGATGGAGGAGGCAGTGCGAGTACTGCACCGAGAGGGAGTGAGAAGTAC
CACTCAATAAATAGTCTTGTAAGTGTATCTTCCGACAAGAAGATAGCCGAATGTAGTTGTTGCAGCTCCTAACCAAGTCGGAAGCAAGTTAGATGTTTAG
TATCAAGCATCGCCGGAATCCAAATGATAAGCATACCTGAACCGCGAAGACACTTGACAGCACTGGTGCGAGAATAAACGTAACGAGGCAGTCTCTATGA
GCTGCAGTCGAAAATTTGCGGAAAATCGGAGTCTTCAACACACGAAAACTTTTGCGCAAAAACTCCTCTTTCGTTTCAGCAATCTCAAACAGAGACAGAA
TATCTCGACGACGGGGTAACTCAGGATCGCTGAACGGCATCGAGAAGAACTCCATGAACTCCCACGCAGTGAGCTGGCTAGCGCTATCGATCGCTTTACG
TGTTCGGGCACAGGATTCGTCGTCCAGCGCAAGACCAGCGCGACGAAAAAGTTCCAACCACGGGAAGATTCGCGGTCCTGACTGCTTCTCTTTTGCACCG
GAACGAGAAATGATTTCTCTTGTGGAAGTCTGCATCATTGACATAAGCGCACGCTTGCCACG