Description :
From Genome Similarity Track
Location :
Scaffold_5:747785- 761924
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002397Similar to DDB_G0271670: Uncharacterized protein DDB_G0271670 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G002396Similar to DNHD2: Dynein heavy chain domain-containing protein 2 (Homo sapiens)
Pytul_DAOMBR144PYU1_G002395Similar to DNAH6: Dynein heavy chain 6%2C axonemal (Homo sapiens)

Sequence
14139 bases(100 bases per row)
ATGGCGAAGCGGCTTAGCATCGTCGGCGCCGCGGACGCCAGCAGCAGTGGCTCACGATATGTGGACCCGCTGTACGAGTTCGAGGGCGCGCCGCGCGCGT
TCTTCGACCTGTCGCTACCGCCTAAGTACGACACCGAGGACGAGATCGACCCGTGGTTCACCATCGTGCACCCGGACCACAGCCGCCCGAGCGCCGAGCT
CGCGCAGGAGGAAGCCGAACTCCAGCGGCAGCTCCAGCTCAAGCAACAACAACAACAACAACAACATGTCGACCACAACAGCAGCAGTACGATACATGCA
CCCAACGCGTCTGTAGCTGCTAGTACGAGTAATGGCTCCACCAGCAACCGTTTGGGGGCTGGGTTCCGGCCAAAAGCTAACGTGTTGAACCCGACAGCAG
CGCTCGAAAAGGAAAACCGCAGCGTGGAGCGTCCGCGTCGCTCGAATGTCGCGACGGGACTCGGGGGAAGCGCACGCGGTGACTTGCACAGCAGTGAGAA
CGGCAGCAGTGCGAAAAGTGCCAATCGTCTGCAACCGGCACGAGGCGCAGGTTCTACCCCAACAGCGGCAACAACAACGACGACAGCAGGAACGGCCCAT
GTGAGCGGGTGCGTCATAAGCAGCTACATACGTGTATGGTAAGCTGCTATGTATTGATATGTATGGGCGGTGTTGAACTCTGTTTGTGTTTAGACCGCCA
GCGAGACTGCGGAGGCGATCTGGACTTGGCGCGGCAAGTGAGGAGACGCCGCATGCAGGTGGCGGAGAAGCATCCAATAGCGTCGTGCGCGTGAAGGCGC
AGATCAAGACCACGATCTACTCTGCTGCAAATACTGACGCGGCAGCAAGGAAAAGAGAGATCGCAAGGGAGCCATCTGTTCCGCAAAAGCGTGCAGCAGC
TCCGAATCATGGCGCACGTGCTCGCTTCATGGCCTCGACAGCGAGCAGCCGCATGGCGATGCAGCATACCCCTTCAGGTGTATCGAACGACGAAGCCAAG
CAGTCATCTGTTTCTCAACGAGGGGCGGCGACGTCGAGCGTCAAGGCAAAAAGTACAGCAGCACTGAATAAAAAGGCCGGAGCATCCAGGCAAGGCAGTG
ACCTCCAGGAGCTCCAGGAGCTCTTGGCGCGGCACAACAAGAAATTCAAAGCCACGCACACGTACCAGCCGCCGCAGCACTCCGTGCGGGATGTGCGAAT
GGTAAGAAGTGTGCTGTAGTGATGAGCATGTGGTTGTGTGACTCATTTGTGTTTGTCTGACTTGATGCGCCGCAGTGGGAGAAGCAAAACAGTTTGTCGT
ACTATAGTTTGACGTCGGAGGACCGCGTGAGAGCCAACTCCGAGATCGCAGAGCTAGTCCAGGCTCGAGAGAACGCAAGACGGCAAAGCAGCGGCTAGAA
GCGGAGACGTGCTGCAATGGAAACTGGTTTGTAGCTCTCTCTATATATCTATTGAAACTGGAATATCAAACTATCAAACGGGCAGAAAACTACGCTTTCC
CAGGTTTTTTGTATGTCGTTGCAAGGACATTACGCTGTGGTTGCTTCTTTCTTATGTGTCCAGCATGCAGAGCATGGCGCAGCCGCGTCGGATCCAGTGG
TCAGGGCTCTTGTCCGTGGGGATGTCCAGCGCAACGACAAAGTTGGTCGAGTGGCCCGTCGTTGAGAGCGTGCCCGCGCGGATCGACGTTTTGTACAGCG
GACACTCGTACACGTCCACGGGCTTGTACCCCTCCTTGCGCATGGGCTTGAGCCAGATAACGGGCATGCGGTCGAAGAGTTCGTTCGGGATCGACTCGGC
CATCATCATCGCGTTGCGGTCGTACCGCGCGCCCTCCATGAAGAGCCCGTAGATGTAGACGCCGAAGGGCGGCGGCACGTGGCACGCCTCCTTGTCCTTA
CCCATGGTCTCGCACGATACCACGAGCGCGTCGATCGCGATCTGCCGCTCGCGCGAGAACGACTGCTTGACGGCCGTCATGAAGCCCTGCGGGAAGAAGA
AGCCCGAGAGCCAAAACGTCATGGGTGGGCCGTTCACGAGCCAGTCGTGCGTGAACGCGATGCGTGCAAAGAAGTCCTCGATCCAGGCCGCGAGCGGCTT
GAGACATGGATACCCGGCGTCCTCCCATTCCTTCGGGATCTGCTGGATGAGGAACCCGTTGTACATCTTCTCGAGCGCGCCCGACATGACCACGAGCCCT
TTGATCGCACGCTTGAGCATCTCGAGCGTGCTCTTCATGACGCGGATCAAGAAATTAAAGCGAATCATCTCTTGTGAGAGGAACACGCCCAGCGAGTTGC
GGGATCCACCGAGCACTTCTTTGAACGTCGACGCGTGCGCTCTGCTCTCGGCAAACAGATCGGGCATTCGCTCCTGAATCGACACAACCATCTCCATGAC
GATGCTGTCGTTGCTCTGGGCGGCCGACGATCCTCCGCTGTCGCCTCCTCCACCTCCTCCTCCGAGCATTCTCAGGATCGTACCCAGCAACTGCCCGGTC
TCTTTCTGCTGAAACGTGATGTCGGCGTTCGCGTGAAGACCGAAGATGTCGGGCGCGTCTGCAGTCGGCAATGAGCTCACGTACTCGCGCACAGACTGGA
GACTACCCTCGGGTGGCGCAAAGTATGTGTTAGACGTCGTGAACCGGTACGCATCGTCCATCACATTCTTGCAAAACAGTTTGCGCATGATGCTCGAGTT
CGTGCGCTTGTCCCAGCGATCGGTGATGCGGCCGCCGTAGGACACGTCGGCGACCATGACGTTGAGCGTCACGTACGGCACAGTGTCCTGCTCTTCCAGG
TACAGTCGCACTTGCTGCATGCCCGTCTTCAGGTCGCTGTTCATCCATTCATACGGAATATTCCAGCCCACGGCCCCGAACTTACGTCGCTCCAAGCAAA
CTGCATTGTAGAATGCGAGCGCGAACACGAGCTTCTTGAACTCGCGCTGCTTCGTGCACCCTTCGTAATCGGACTCCTTCATATCGAGGAACGTGCGGCC
GAGGTTCGCACGGATACCCTTGGGTGGCTCATTGGTGATCTTGATGCCGTTTTGCAGGATCGGCACAGGGAATCGTGCGCTCGGCATGCTCGTGAGCCAC
AGCCGGAACTCCGGATGGATGTCTTCGCTCTGCGATTGCTCGAGGATCTGCTCCAGTCGTCCGAGCCACGAGACCGCGAGGTGGCAGTTCTGCAGACACA
CCCAGTCGCCCGTTTCCTTGGATTGCTTCATCAGGGCTTCAGCGATCGGGCCTTGGCCTTGGCCCAGCGAAATGATCTTGAGCCCCGAACCTTCTTTCCC
CTCTTGCTTGGCGAGCTCGAGCAGGTAATCGCTGATGTCGGCACCAGGGGACAGCACAAAGATCAGCGGCGTCTCCGGTTTGGAATCCCGGTAGCAGCCA
TTCAAGTCGAACGGAGGCGACTCCGTGAAGAATGTGCCGAGCTCGCGACCGACAAACTCGCGTGTGCCGAACACGAGCATCTCTTCGCGAAACACGCGCA
GAATCAGCAGCTTTTGGAAGTTCATCAGCTTGGTGTCCCACGGAGCAGGCAACGGCTCGGCGTGCGGGAGATCCGAGAGTACCATCGCCTTTTTCCAGCC
ATTGGCATCACGAATCACGGATTCCGGGATTTGGTCGAACGCTGGCGAGATCTCCTTGAGTCCGAGCAGCACTTTCCAGACGCGGTCCGAGAGCCACAAC
GGACGCATGAGACCGCTCGACGCTGCCAACGCGATCTGCGCTGCAGGGCTTCGTTTGTCGCCGACCAGATAGAAATTCCATTCCTGCGCGTGGATCGCGC
CGCGCTGCAATAAGATGCTGGACGCGACCATGAACGCGAACACGATCTTGTCTTTCTCAAAGAGACCGCGACAGACGTTCACGAACATCGACATGGTGAT
GTCGCTCATCAAGATTTCGAGTCGCTCATCGAGCACGTCAGATTTTGTCGAGTTCTCCAGACGCATCACAAAGAGTTTCTGGTAAAACTGGAGCGAGTAC
TGGTACATCGGGTCCACGAGCGCAAGGCTCGCAATTGCAAAGTAGATGATTGAGCCGCGAATCGCAACGCAACGGTACCCTTCGCGCGTCTGGTCGATCT
CGAGCGACGTCGTCTCGGCCTCAGCCATGCGCGTTTTGATCGCCGACGACGTCACTTTACTGTGTGCGAGCGTGTCGATGAGCTCTTCGTCGTCCAGGAT
GTTGCCCTGCGAGTTCTCGAGCATGTACAGGATCTTGTCCTCGATCTCCTTGAGCTGCTTCTTGTCGGCCGCGATGTTGACCGTAAGCTCGTTCTTCTTC
TGCTCGAGGTCCGGCCGCTCGCTGCGCACGACGTCCACCAAGAGCTGGTCTTCAAGCCCCGTGCGCGTGACCGTGAAGTTGATGATCGTCACTTTGATGC
AGATCTCGGGCATGTAGTGCGGGTTTGCGAGCTTGGTCGTGATGTAAAACCGGAAATTCTCGCTGTACGGCACGTCGCTATCTCCCAAGTGTAGCAGGAA
CTGTCCGCCGCGCTTGAACACCTGCTTGAGTAACACGGGCTCGAGCGACGGATCGAGGTCTTCTTCGACGTTCTCGAGCAACACAGGCGCCCCGTAGCGG
ATCGCGTTCTCGAGCGTGCGCAGAAAATCCTTTTGCGTGAGCTTGATGATCTGCAGCGCGTTGCTCGCCTTGTACATGTTCTTGATCCACTTGTTGGCCT
GCCCCTGTGGGTCGATCATGAGCGGCCAGCGGCGCCCGAGCGTCGTAAACAACCCATTCTCGATCGAAAATGTGTCCGCGGGCAGTCCCATGATGTTCCA
TTCGCGCACGACAACCGGGTCTGCGAGCACGCGCTGAAACGAAAAGTGGCTGTCCACGGGGAGTCCACTCTGTTTGCAAAACGCGACCCATTTCTGCTGC
AAGTCGTGGCGAAACTCCGCGGTGAAGGGCCCCAAGTACGCAATGCAACCGGCCGACAAGATCATGTCGCCGACGAGATTCACCATGTCGATCGCGAGGC
CCTCGGCGCATTCCTTCCAGCGACCCTGCTCCTCTCCAAGAGAGTCAATGAGCCGCTCGGCACGCACAAGTTGCGCCTGCGTGGTCTGCGTCTGCTTTTC
GAGGTCAATCTTCTTCTGCTGCGCGTCCTCGAGTGTGCGTTTGAGATCGGCAACTTTCTTGAGCACGGCGTTGAGTCCAGACTGCTTGACCTGCAGCTGC
TGCTGCTCACGCTCGAGCCGCTCTTCGGCTTGCTTGAGGTTCTCCTTTTTTGGGGCAATGTTCTTCGCGACCGTGTCGTACGTGTACATGGCGCGCGCCC
ACATGCACAGCGACGTGGCGGCCGTCGAGATGCTACTCAGCGTCTCGGGCGTGAATTCTTCGTCGGCCATGAACTTGGCGAGCGCGCGGATCGTCTTCGG
CGGGATGTTGTCTTTGTCGTACTCCTTGAGTTTGTCGAGAAATTTCATATCGTTCAGCAGCTTCTTGGCTTCGTTCCACTCCTGTTTCACGCCAAAGAGC
AGGCACACGGCGTTCATCGTGACGCCGACCAGCCGCGGTGGGTTCGTGAACGTCTTGAGCACCGTGATATCGTCCTTCTTGAGCTGCGACAGCGCTTTGA
TCGATGCATAGTACGCCGGCATGGCTTCGTCCAGATCCTTTTGGCAGTCGTCCTTGATCGCCTTCACTTCGTCCGCGATCTTGTTGGCGGCTTCGACGTC
GCCCTGGATGAACCGCTGCTGCGTATCGGCTTCAGCCTGGTCTTTCGCGACCTGTATGAGCAGCACGGACGTGTCTTCCTGCGCCTTCACCAGCACAGGC
TGCAGATCCGTCAACGATTTCTTCAGGTTACCCACGATTTCCTCGGTTTCGAACAGTTTCTTCAGGCCGCCGCGGTATCGCGCTTCTTTCGCTCGCACCA
AGTGTCGATGGCTGCGCAGCATGTCGACGTACAGCTTGATGAGCTCAAGGTAACTTGTGGGCGTCGTGTAGTTGTGGCGCTTGAGCTGGTGGTAGAACGT
GGCCGTGGCCTCTTCAACGCTGCGGTGAATCGTGACCGCCATCTTGCAGAGCGTGTCGACGTGGCTCTCAATGCCCAATTCCTCGGCACTCGTCGCGAAA
AAGCGCTTCGCGACCGAGTGCAGCGCGTCTTCGGGCCACGCGTTGAACCAGTCGATCGTGCAGCAGTTCACGAGTGACGGAAACATACGGCATCGGTTCC
GGAAGCCCGCGCCGATGGGCGACACTGCGAGCACGATGTGCAGGTTCTCCCGCACGAGCGTGACGTAGTATTGCAGGATGTCCTCACGCGTGACTTTGCC
GACTTGGGCCGCGATCGGACGCACCATGTTGACGATCTTCTCGATCTCGTCGCTCGCGTACAGGTTTGGGACTTCGCCCGTGTTGAGCACGTTGTTGATG
TCTTCGAGAAACGATTCGTGCACGATCTGCGCGTCCGAGAACAAGAACACGACCGGTTTGTTCTCGGCGCCGGCGGTCATGAGCACTTTCTTTAGGTCTT
CGTGGAACTCGTTCGCGCCGTAGCCACGTGTGATCTCGATTGAGAAACACTTGTACTCGGCCATGAACGCCGCCAGCCGCGTCAGACTCTGTCGGCCGGA
GCCCCCGACACCGACGAGCAGCGCATTGCCGCGCGGTTGCCGAAGCACGCGACAGATCCGCGAGATGTGATGCACGGCGTCGTTGAAGAACACCAGATGC
ATCTGGCTCGGGAATGTGATGTTGTACTCCTCGAGATACTCCATGAGCAGCGTATGGAGCCGCGTGAGGTCATCCACGGGCCGATACGATCGGTTCTCTC
GCGTCAGGTAATCGCCATACAGCAGATTCTCGAATGACGCAGGGGTCCAAGAGACATTGACGTGTTCCTGCAGCAGTTCCGAGCACGCACCATTGAACCA
GCGCCGGTCGTCGGCATCGACGAGGCGATCGCGGAACACGCGCGCTTCCTCGTGGAGCCACACCTTGAACAGTCCTTCCTCGTTTGTGACGCTGTCCTTC
TTGATCATGAGCATGCCCTGGAACACCTTGGACAAGTCACGCAGGTTGAACGTGTAGTGCGACTTGGATGGTGTCGGAAGCATCTCGAGCTCCACGCGCT
GGTACAATTGCATCGACGCATTCACGATCGGTGTCGCCATCTGGATCAACAGCGGGAGCTCAAACGTGAGAAACCCCCCGAGAATGGACGAGAAGATGCG
CTTCATAGCCTCGCTCGATAGATTCGGGATCCAGACCATGTGGAAATGCCGCAAGAGTCTCGGCGAGACCTCGCTGCGACCACCTCCGGGTGGCGCACAC
GCGGCCGTGAACACGACGTCCTTGATGTTCTTGAAGAACATTTTTGATGTGTCGTAGAATCCGCCCTGATCGATGATCTGCCGTAGGAGTTCGTTCGGTG
GCTGCGCGCCGTAGATCTCGAGCGCCGGCATGTTGAGGTCGTCGACAAAGAACAGCATCCGCTTGCCCGTCGGTGGTCCGAGCAGGTTCTTGCGCTTCTT
CTCGAGTCGCAACTCAAACTGTTCGTACAGATTCCGCGGTTTGGTCTGCGCCGAGTAACTCATGGTCGCTGAGATGCACGAGTCGGTCTTGGCCATTTCA
TCGAGGAACGACTGGATGATCACGGACTTGCCCACGCCCGTCTCGCCGCTGTAGAGCACGTGGTGGTCTGCAAGCAGCAGCTTCTCGAGAAGGTACCGGA
ACCGCGTCGTGTCCTGGGTCGGCACAACCATGCTAAAGTACGACGCACCCGACTGGAACGTGAACCGCGGCGTCTTCTCGACCCAGGACACCCACTGGCT
CGTGCTCTCATCGACCACCACATCGTACACGTTGTCGACCATCTTAGCGCTCGTGCTGCTGGAGTTGTTGCTGTCGCCGTTGATCAGCGCGCGGAACTGG
CCCATGCAGAAATCGTTAAACTTGGGCCGCGACGCGTCGTCGATGTTGGCGCCGATCGACCACGTCACGGCAAACACAAAGTACATGCGCAGCAGCGCCG
CGAGGTTCGTGACGTTGCTGTCAGCCTGCGCGACGCCATTCGTCAGACACGACGCGAGCAAGTTGAGGCATGCGGTCATAAGGTTCGCATTGTTGCTCGC
GATCTTCTCGCGGCAGTGGTCGCGTACGAACGCGATCGCGATCGGCACGTGGGTCTCGATGAGCGCGAGTACCATGTTGCAGAGCTCCGGCGACGACAGC
ATCGACTCGAGCGTCGTCACCTTCCACGTGCGCGCCAGCGAACTCATGCCGACGTGCACTTGCTCCATGTACACCATACCGCAGCGGCTCACGGTCGCCG
GCGACGCCACGCGGAGGTCCTGGACCTCAAACATCATGTGCAGTGTGTGCGGGAGCTTGATGCGCTCGCTGTTGGACAGACAGAGCGTCTTGTTGTCGTC
GAGCACGGTGTTCATGTTCTCGATCCAGACGGCGTCGACGGGGCCGTCGAAGATAACCCAGTCGCGCGCATCAGACTCGGCGGCGTCCTGCACGCACTGG
CGCACGAGCTTCGGCACAAGCCCGTCGGTCCATTCGTTCGTGAGTAGGTTGAACTCGCCGTAGAGCTGGCCCGCTGAGATCGACTTCGGGTTCAGGATGA
GACGCTGCACGACTTTGTAGAACCCGTCGCGATCCACGACGCCGTCCTCAAAGAGCTGCGTCAGCGCGCGCGCGAGCACGTAGCAGTTGGTGCTTTTCCC
GCTGCCGGCTTCGCCCACAAGCATCATGCCGTGGCGCACAAGTTGCGTCTCGTGGACTTGGATCGCCTTCATGATGAACGACGGCACCTGCTGCAGATGC
AGCAGCTCCAGTTGCTTCTCGATCGCCTTCTGTAGCAATCCGTAGTCGACGAACGGCACGACGACGCTAGGAAACAAATCGGCAATGATGCCTCGGAACA
ATGGCAGATCCTGCTCGAGAAATTTGGGCACGTTACTGTCGCGCATGGCGCGGATCAGCAGTAAATCCTCGTGCATCTCGGGTTCCTTGCGCTTCAACTG
TCCCGCCGCGACGAGCACGGACTTCACGGCACGCATGCCAAAGTCGTAGTGGTCCTGTTTCGACAATTGCTCACTCGAGAGCGAGTACAACTGCGTCATC
TTGTGGGAAAGCGGGAGTGCGTTCGCAAACCCCTCGGAGAAAAGCACGATCTCGGCGATCAAGCGATAATCCGGGACCATCATCGCTACGGGACGAAAGA
GCGCCTTGAGATTGTCGGGAAGCTCCGTGCGGCCGGCGTAGCCTGGATTCATGGTGATGAACACGCCAAAGCCCGTATTGAGGCGGATCATCTTGCCTTC
GAACTCGAACTGATCGACGTCGGCGATGATCGCCTGCTGGATGCAGAGCACCTGCTGCGCAATCACCGAGAGCACTTCGATGTCGATGCGATTGAACTCG
TCAAAGCACGCCCAGGCGCCCGCCTGCGCGAGTCCCGAGAAGAACCGCCCCATGATCTTGTAGTCCAGGCCGTCGGAGCAGTTGAACACGACGCACTGGA
CCGCGAGCGCCTTGGCCAAATCCTTCGTGGTCTCCGTCTTGCCCGTGCCTGCGGGACCCGCAGGCGCACCACCGAGACGCAAGTGCAGCGCGCCCGTGAG
CGTCATGTAGCAGATATCCGTGAGCGGCGTGATGACCAACCGCGGCGAGTTGCCCAGGTACTCGTACCCGTAGATGAACCGCGTGTTCGTTTGTCGCGCG
ACAAAGTTCTGCACGTCATCTTCCCAGTAGTACCGAAGCTGCCGTGTCCACTCAAAGTCGCTCAGTGACGCGACGTTGCTCTCGTCGAGCGCACGCACGA
CGTCGCGGGCATGGACATCGATCGTGATGATCGCGCCCATGAGGATGCGCTGCAACTTGGAGAGCGAGCCACGCACGAGCTGTACCATGCCGTCGATTTG
CTTCAAGCTGAACTGCAGGAAGCCGCGGATCGCGTTCGCGTCGTTCCCGTTCTCGACTTGCGCGATCGCTTCAGTCACATTGCGCGTCCAAAACACTTGG
TCGACGAGGATCACGACTTGCGCCGAGTACCCAAAGAGCCACTCCTTGCGATCAATCGCGTCCTCGATCGGGTAGTTCGTCAGCGCCTTCACGCCGTCTT
CATACAGACTTGCGCGCATCGCTTTCTCGACGCCAACGAGCCACGTCTCAACAGGCCCCGCGGCCGTGACCAGCGACGGGAACTCGACGACCTCGCCTTC
GCCACTGATCATCGCGTTCACGAGGTTGTTCGGGTGCTTTGCGGAGCTCGTTACGGCGCTGTCGTTCTCAACAAAACGAATGCTTTTCATCGCGTCAAAG
CATTTCCCGAGATGCGGTTGCACGGCGCGCGGATCCCGCGTCTGCGACAGGATCTCGAGCAATTCGTCGTTTGACAGAAAGTAAAAGCGTGGGAACCCCA
TGCGTTTGGTCTCGAGGTAGTCTTCGAGCGACTTTTGGATCTCTTCGAGGATCTGGTTCGACATACGGAACTGCTCGAGGAGATCGGATCCGGACTCGAT
GGACCTGATCACGCTCGGATCACTGTTCGTGCGCAGCATGACGGTCTTCCAGTTCTTGTCGACAAGTGTAAACTTCTGGGCTTCCACTGGCAGCTGCTTT
TGAATGTCTTCGGCGCAAAAAATCGTCTCCAGATACATCCAACTGCGCTGGCACGTGATCCACTCGTCTAGCGAGTCCGAGAGCAGCGAAAGCTTCTTGT
TCCATCGATCGACCTCGTCCTTGACGCCCATGATGAAGCGCGACCCCATCATCGTCTGCAGCGTCACCTGGTTGTCCTCCAGCAACGTCAGGATGTCCTC
GAGGCTCCCGAGGATGAACACGTCCTTCTGCTCACGGTGGCTGATGCACGTGAACTGCATCTGATCCCAGCCGTGCTTGATCTTCAGTAGGGACGCCTCG
ATCTGCGCTTCGCCCGACGCTGTGGACGACACTTCGCCGATGAACTCCTTCATGTCCAGCACGTCGTACGCGATGAGGTTCTCGAGCGTGAACATGATAC
CAGGGTACCACGGCTGCCGCAGCGCCTTGAAGATCTTCTCCCAGTGGCGGTCTTTCATTGCGGGGTTGCCCAGTTCCAAGATCGTCGGCATCTTGAGCTT
GAACTCGGCTGTGCGGTCCTTGAAGAGTGTTGTGACGTCGTTGCTGAGCTTCTTGTGCATCGCGTACGCGTCCTTGAACGCGACCGCGATCTCCTTGGAG
AGATCCTCGACGTTGACTTCGACAAACGAGTTCGTCATCGCAGCATGGTATGTTGCATTCCACTTCTCGACTACGCACCACAGCGTATCGACAGTGCCAA
AGAACTCTTGCGTCGCCTGCAGGTTGAGATACTTGAACGGCGTCTGATTGAACAGTACCTGGTACTCGGTGTACTGCTTCGAGAGCTCGTCGAGTTGCGT
CAGACGCTGCTTGGTGCTCTCGAGCTCGTTTTTCACGAGCGTGGAGTCCTCGAACTGGTCCGGGTCAATGAACAGACCGGTCTGTAGTTGGCTGTTGAGC
TGTAGTACTTGCTCGTCGAGCCGTTGGATGTTCGCATCTAATTGCTGGGTCATATCGGCGATCCGGCTCTGCACGAACGAGTCGACGGCGTCGGTCTCTT
CCTTGTAGTTCTCTTGGACGCTGCGCAGGTCGTCGAGTTGCACCATATCCTCGGACGAAATGCGCACACCGTAGTTTCCGAGCAGACGATAGAGTTCGTC
GACGACGTTCGTGTTCTTCGAGAGCGCTTTCTGCTTGGCCTTGAGTGACTGCACGCGCTCAACATGGCTCGCAAACTCCTTCAGGTGCTGCGGACGCTGC
AGCAACGCCTGGATGCGCTGCTTGTACTCGATTAGTTGGTTCTTGCACTTCGCGCGAGCCAAGTCCTTGACGAGCCCTTTCATGGAATCCAGTTTCGCGG
TCGTCATCGGGATTAGCGTCTGCTTGAGCTTGCGACTCTCAACGTGAAGAATGCCGATTGTCTGACCAGCACGCATTTTCTCGAGCTCTTTCTCCCACGT
GCTGATCTGGAGCATGTCAGTCTTCAGTGTCGCGACTGTGTGCGCGCGCTGAGCGTACTCATCGAAGTCCCAGACTTTGTCGTACTCGTAGATCGGGCGG
ACGTTGTCGAAGATCTTGACGTACTCGGCGGCCTCGCCGTAGTCCGTGATGATCTTGGCGACCAAGTCCTTGCGGATCTGCTGGAAGTCGACGCTCGTAC
TGATCGTGAGCCCGACATGTGGTGCATCGGCGATGGTGTTCGCAACGTAGGGCGCAAACGGACGCAGGTAGAGCACACGTGAGACCGAGTTGACGGTGTT
GACGATGTCGTCCGTCATCGCGACGACGATGTGCTGGATCTGCTCGCTCGTTGGCGCGAAGATCGTGCTTTCTTCGCCGAAAAAGATCGTGGTCTCAAAG
AGTCCGGTTTTGCGTGGAACCTTGTTGAGTTCCTGGAGGAATTCGCGGCAGCTCTGGATCGCCAGGACAACGAAACTCTCGACGGCGACGTAGTCGATGA
GGCGGATCAGGTCGGCAATCATTCCGGCTTCCTCGGCTGCACGCTTGAACAGTTTGCGGCGCTGCTGCTGCTCGGACTTCACGGCCACGATCGACTTCGT
TTTCTCGCTCTGCATGAAACTGCCACCATGACCGCCACTGGATGCCGCATTCGTCTCGTTCGAGAGAAATTCGTCTTGCGGATCCGACGCCGCGAGCTTC
GTCAGGTTTTTCACGTCGACGCACACTTTTTGCACGATCGCCTGCAGTTTTTCAATGCACGCCTCAAACTGCTTGGCAGCGTCGGCGCGCTTCGTCGCCT
GATACTCGACGAACGCCGTGCTCTCGTACGTCTTTTGCGCGCGCAGATCCAACAGCACGACGCTCAGAACCTCGGTGCTCATCACTTTCTTCACGTTCAA
CAGTGGCTGACAGAAGCTCGCTTTCGCGAAAAACAGCTTCTGCTGCAGCTTTTTGCGCTGTCGACAGTACAATTTGAAGCGCACGTTTGCTCCCCAGCGC
GAGAACGCCTTGCTCACGAGGTAGTACTTGAAGAACCGGAAGGACGTGAGTACGTTGAACAGCGTTGATTGGCGCATCCACTCGGCCAGCGCGATGAACT
CGGACGGATTCCCCGGACTCATGTGCACGAGGCCGCTCGATGACATGGTGAAGTGCTCGCTCGCGATGTCATCCTGGGTCACGACCACGAGGTCGTACGG
ACGAAATGCGATGCCTATGTGTGCGCGGTTCAGATGCACGAACTTGACCTCGCTGTCCGAGCCATTGCGCGCGAAAAACGCGATCGCGTCTTCGCCCGTC
GTCAAAAACGACGTAGCTGAGGCTGCGGCGGCTTCAGCTTCGGCGTCCGCAGTCGCAACATTGCTGGTCTGCGTCGCCGGGTCGTGATGCGCCATGAACA
ACGTTGAAGACGATCGATCTTGGTTCGTGGTGCTCGTGCGGTGCTGGTTATGGTACATTTGTGAGCGTCGCGATGGTGTGGACGGATGCTGCGCGTGGTT
GCCATAGTCGTCATCATCATGTTCATCATCGTGGCCACCCATTGATGGCGCCTGCGAAGCGAGGGATTCGCGGAGAAACTTCCGCGGAGACGCTTCGCGT
TTGGGTCTCTCACTGACGCTCGGGACGGACACGCTCTTATGCTCGTTTGGGCTGAGGAACGGCGACGCTGCTGCTCCCATTAGCGGTGATGGGACTGACG
CATTTTGCTGTTTGGTGTGGCAGGGACTCCGATGCCCGGTGACACTTTTCTTTTTTTCAGGGCTGCTCTGTGTGCCGGGGAAGACAGGAATTTTCTTCGG
GGACGTGTACTCGCCTGCACTGGTGAACGCAAACTTGTGGGTGGCCGCTGAAGCCGACGGTGCTTTGTGTGTAGACGACTGGAAATGAAGCAGCGACGAT
GCATGACTGCCACCAACGTCAGCATGCATGGGGCTCGCGGGCAACGGACGGTTGGACGCGAGCGTCACGCCGAAGCCAGAGCCGCCGTCGAACTCAAACG
TCTGATCGATCGCGAGATCGTAGATCGCGTGGCCCGCGACGGATCGAGACACCGATCTGTCGTCCTTGTCTCTGTCTTTGATCTTTACGGCACCATCTCG
CAGCGGCACCTGCGGCTTGCGTCTTGCGTTAGAAGACTC