Description :
From Genome Similarity Track
Location :
Scaffold_8:74770- 76851
Transcript NameFunction/comments
Phyci_90116myosin-like protein

Sequence
2081 bases(100 bases per row)
GGACGTGGACGACCTGACGCAGCTCATCGAGCTGGACGAGACCACGATCCTGTCGGCGCTCGAGACGCGCTTCTCGCAGCACAAGATCTACACCAACACG
GGCGCCATCCTGCTGGCCGTCAACCCCTTCCAGAAGATCGCCGACGTGTACAGCACCGACACGCTGGCCAACTACCTGCTGTCCTTCGAGGCGCGCAGCA
GCTCGCTGCGCAACAAGGGCAGCGACCCCATGCCGCCGCACATCTACCAGGTGGCGGGCGAGGCCTACAAGGCCATGATGCTGGGCCTCAACGGCGTCAT
GAGCGACCAGAGCATCCTCGTGAGCGGCGAGAGCGGCAGCGGCAAGACCGAGAGCACCAAGTTCCTCATGGAGTACCTGGCCCAGGCAGGCGCCAACAAC
CTGGCCGCCTCCGTGGCCGGAAAGAGCCCCGGCGGCATCGCCGCCAAGGtgctgcagaccaacattttgctcgagtcgttcggcaacgcgcgcacgctgc
gcaacgacaactcgagccgcttcggcaagttcatcaagctgcacttcaccagcggcggcagactcacgggcgccagcatccagacctacctgctcgagaa
ggtgcgcctcgtgtcgcagtccaagggcgagcgcaactaccacattttctacGAAATGGCCATCGGCGCCGACCCCGCCGCGCGCAAGCGGTGGTTCCTG
GATCCACCTAATGGCCACTTGATGCCCTCCGGAGACCACGAAGAGGTGACGGAGAGCACGCGCCAGTTCCTGCACTACAGGTATCTGAACCAGAGCGAGT
GCTACCAGCGGCGCGACGGCGTCGCCGACAACGACATGTTCCGGCGCGTCAAGGACGCCATGGACATTGTGGGTTTCACTTCCACAGAGCGCGCGGGTAT
TTTCGACATCCTCGCGGCGCTCATGCACATTGGTAATTTATCTTTCGAGCACGATGAAAACAGCGACAGGTTGGGTCAGTCCATGGGCCCTGGCGCGGGC
AAGTCCGACTTGGCGCCGAGCTGTATTTGGTCGCGTGACGCGGCTGCTACGTTGATGGCGGTGGATGCTACTAAACTCGAGCGCTCGCTGAGCGTGCGCC
GAATTCGTGCTGGTACAGATTTCGTGAGTATGAAGTTGTCAGCAGCACAAGCTAATAATGCCCGTGACGCTCTTGCCAAGGCGTTGTACGGAAAACTTTT
CGACTGGATGGTGAAGAAGATTAACCATTTCCTCAAGATGGACGACAGTCAAAAGGCCAAGGGTGGCTTGCATTTTatcggtatcttggatatctttggc
ttcgaagtgttccctaagaactcatttgaacaactatgtatcaactttgctaacgaaacgctgcagcagcaattcaacgactacgtgttcaaggcggagc
aACGCGAATATGAGTCACAGGGCGTGGACTGGAAGTACATTGAGTTCTGCGATAACCAGGACTGTGTGAACCTTATTTCTCAACGACCGACTGGTATTCT
ATCGCTCATTGATGAAGAGTGCGTCATGCCAAAGGGAAGTGATACAACATTGGCGTCGAAACTGTATCGTGCGTGTGGAAGCCATTCACGCTTTGAGGCT
TCTCGGATTCAGCGGGCGCGTGGCCTTTTCACGATTGTACATTACGCAGGTCACGTTGAGTATTCTTCTGATGGGTTCCTGGAAAAGAACAAGGATGTCC
TCCACCAGGAAGCTGTGGATATGCTTGTGTATTCTACGCGAGAGGATAGCTTTACGCGTACATTATGCGAGGGCCTTGGTGGCTCTCGTGACCGCGCCAA
ATCATCACCGCGTCAGCGTGCACAAACCAGCAAGCACCGCGGTGCGAGTGTGGGCCTTCAGTTCAAAGAGCAACTGACAACTTTGCTCGAAACGCTGCAG
CAAACCAATCCGCATTACGTGCGATGTCTCAAGCCAAACGAATTATGCAAGGCTGGTATTTACGAGCGCGAACGTGTGATGAACCAATTGCGCTGCAATG
GTGTGATGGAGGCTGTTCGTGTGGCAAGAGCAGGATACCCGATCCGACTACCGCATGATGAGTTCGTAGCTCGGTACTTCA