Description :
From Genome Similarity Track
Location :
Scaffold_597:7477- 11553
Sequence
4076 bases(100 bases per row)
CCCAAGTAGGCTCATCGTTGCCGACCCACTTAATTTTAAACTTCCGTTGTGATCGTGACGTACTCGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTC
GACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCAGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATT
AGTCTCGTCTTTGGTCTTCCGCCGAGTTTGGTGACTGCCTTCAGACGTGATACATGGACTACTGGGTAGAACCTATATCCGCTCTTGTCGGGCAATTCCA
ATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAAA
CAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGATTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCT
TTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCCCGAGCTCGTCGTGCTTTCTCTCGCACTAAGAACTCAGCTGCTAATCGAAGGGCAACTTCTCGTTGT
CTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACGGGGCTTCCCTGTCCACGTCGTATTGAGCTCGTCATAGCCTTGAGTGTAGACTTGG
CGTCCCAACCATGTACCAGATAGAAAGGGGTTTCTCGCCAAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGTGATGTCATCCCAGTC
TGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTA
GCTCTTGATCTCGACGGCATCATCTCGGAGAACTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACT
GCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCGTGAAGTGGTCCTGGAACAG
CAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGGAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAG
TAACCTCTCAACTGCGGCTTGCTCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAGGACCAATCCAGAAGTAGTCGG
CCTTGACTCGGTGATAAGTTCTGACGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCATAGTTGACGGAATCAC
CAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGGCGAGCTTCATCTCGGCGGTATAACAAGCCGTCTTCGCTGAGTACAAAGACTTCTGCG
ACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCACCTCTCAGGTACGCCTTTAGATCGGCCCACCTGAGTTCCTCATCTTGTGCCT
TCGCGATTCGTCGTCTCCGCTCAGTCTGTACTGTCACTGGATCAATGTCGTTAAAATTCTGAGCTGTCTGGGCTGACTCCATTTGCGACCCTGTTTCGAC
ATTCGGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCTGCTGACTTGTTCAAATTCATCTCCACTGCTTTCAAACGCAGATTCTCCAGGGTTTGTTGAC
ATGGCTTCGTGATCCTGACTTCCTCTTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGGCTACGAGTAACTGCCG
TGACAATCGGGGTTTCCGCTGGGTTGTCTGTGGCGTACAGCTCTTCGGCTACTCGGTTAATCATTCTCAGTTCTGTTTTCCTATCCGTCCCGAGAATTAT
TTGTCCAGCTTTAGCTTCAAGTGCTTCTGTAGCGAGAGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGCTTC
GTGAGATCCTTGTGTCGAGCTAGCTCCACTTGCAACGTTTCCTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCCCCCACGA
TAATCAGATCGGTTATCCCTCGGTCAACCGCCGCCAAGACTCCATTGTTCATGCCGGTATACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACT
CGCAGTGATCTCAATGTCCCAATTCGGAAGGCACCACAGTATCCACGAACAGCTTCCATACCCGCCGTATTTAGCTGTCTTCGCTGAGCCATCAAATGAC
AGTACGCATCCCGCAAAGTCAGCTGGTATTCGGGCGTATAGCAGCTCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGAAGGGAGACGCAAGGTGCTTCA
AGGAATCGTCGAGTCCGATAAACGGGTTATCGACGCCTGGGCAACTGGGCGAAGTCTACATCTCGTTCACGTACTCGCTTCACCTTCAAATCGTAGGGCG
ACAGCATAACTGCGAAACTGACTGCGCAGCCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTGAAGAAACGGGTGTAGACGTGTAGCGTCTTTCC
CGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCAGCGGGATGATACCCGAGTTCATTCTCCTTCAGTACGCGTCCG
CAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCACTCATTGGCGTACAACATTATATGTACTTCTTTCGCCG
AGTCGAACTGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTGAGCTCGGCGAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGGTTAAAGTCCGTA
TCCTTGAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTCAGGGCACCGAGGAAAGCTTGCATCCCTCTCTTTG
ATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAGTCAACCTTGGGTTG
GACAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCCCCAAGCAGGCGTCGAACGTCTCCCCT
CCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACTGGAATCAAGGAAGACTGGTCAGGTTCTCCATCAGCAAACATGTCGCCGTCCGGTCCAT
TGACCAGGTCTTGGACCGGATCGCACTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGATTCCGTCGAGCTC
AACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAGTTGCCATCCTCCCTTTGGTTGAACGTATCCCCGTAGAGCGTTGTCG
ATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTGTCCAGGTGCACAGACGAACGCTGAGATCTGCCGAG
CTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCACCGAGCGAGCAAAACCACAAGTAGCTTTCCAATTCGGTAAGCAGGTCATCAACCAGTGG
CATAGCGTATTCCATCGATGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGTCGAATATCCCTACCATTTTTCTTGAGCACTATCACCACTGGC
GAGGCCCAAGGGCTGCTCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAG
CTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATT