Description :
From Genome Similarity Track
Location :
Scaffold_574:7477- 8520
Transcript NameFunction/comments
Physo_126033hypothetical protein
Physo_145176reverse transcriptase

Sequence
1043 bases(100 bases per row)
TTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCGAGAGGTTCCACTTATCACAAGCGTCCAGCAGGTGATCCACA
CGATCGCACAGCTCATCCCATGATCCGGCCGTCACGAGAATGTCATCGATGTACGATCTGCGACCTAGCACTGATGGACGCCCCGGATCTTCTGGTTCTC
CTGACTCGATCAAGTCCGTAGTGACTTCACAGTCTGACGATCGCGGGATCCTGGTGAACCCATACAACGCGTCGTCCCGAAGTCGCTGGTAGATCTGAGG
AGCGTTCTTCAAGCCGAACGGCATCCGGTTCCACTCGAACAGACCCATGTGGGTGATAAAGGCCAAGATCGCACGAGCTCGATCGGTGATTGTCACCACC
CAGAATCCACTAGCCATGCCCAAAGAGCAATACCAGAGTACCTTGTCCAGATCTTCCAGCAGGTCGTTGATCAAGGGCATCGGATATACCATCAGCCTAG
TTAGACTGTTGACGAGCCGATAGTCGATACAGAGTCGGATATCCACGCCGTTCTTCTTGATGATCACGACGATCGGCGAGGCCCATGGTGATCGAGATTT
CCGAATCATCTTGGCTGACAATAATCCCTTGATCAGGTCGGACACCTTCTCCACGAACTGAGGGGCAACTTTCCGGACGCGTTGAGCGATCGGCTTCGCG
TCGCCCACGTCGATGTCGCAAGGCGACGCCCCGGGCTGCTGGGGGAGTGCATTGCCCTTGCCGATCAGCAGGTGATTCCTGTGCCAGATCTTCTTTCGCA
GCCGATCGATCTCCTCCGGGGTGTTGAACTCCAGATCACCCACCTTAATATCATCGATCTTCACCTCGTCTATCGTCGAGATCACAATTTCAGGAAGCAC
AGCTAATTCACCTTCGACCTCTTCTGCTGGCAGATTCCCGCCCTCGTGGTAATGGACCTGATCGTGAGCGCCAACGTCTCGATCGGGTTCGGATGTAGCG
AGATCGCCCCGATTTGAAGTGGGTTTGGGCTCCATTCCCAGCT