Description :
From Genome Similarity Track
Location :
scaffold_59:74752- 78954
Transcript NameFunction/comments
Plaha_PHALS_01384myosinlike protein

Sequence
4202 bases(100 bases per row)
AGTATTATGGTGCGCCGCGCGGAGGAATTGCAGGAATGGATCTGTAGCGTCACAGCCTCATCAAACGATCATGGTGAACATCTCTCGGACATGCTGCGTG
ATGGCCAATTATTGTGTCAATTAGCCAACAGTATTGACCCGAAAGCCAATCTCAAGGTCAATAAACTGAACACGGTTTTCCATTCCAAGGCTAATACGCG
ACTGTTTCTCGAGTGGTGCAAGAAGAAAGGTCTAAAAGAAAGCGATATATTCCTGCCAGACGACTTACTGGACACTGATGCtaactttgacagcgtgctC
GAAACACTTTCCATTTTATTTGACAGATTTGGTACGATAGGGTACTCTGGTGAGTACGAAGAAGACCCAGTGTCAGATGCAGAATCCATGACGTCTACTG
GTAGCTCACAGGAAAGTTCACCCGTCAAAAAAGCAACTAATAGTAAACTGAGTAATTTTATGAAGGGTGGTTTTCTATcgagaaagaagaaaaaaggtGG
CGAAGACTTGCCAGGAAAAACACCACCATCATCGCCTCCGCCGATGTCACCTCAGACTGGAGGAGAAATGCTGTCGCCTGAAGGCGCACCACCATACTCA
AGAAGCGACAGTGGAGCAGCGAATGCGAATCGTTTAAACGCTTTTTTAAATCAAGTGCCAGCACCTCACGGATCGCCGTTGACGCACGCTGATCGTCCAT
CGGGGCCTTCGAAATCAGCTAACACAGCAAAAATGGTGTCTGCTACAAAAACACTACCAAGTGTTCCAAAGTCATTATCGACGGGAGGTAACAAGCTTAA
CACCTTCATGAATCAACAACCAGCCACTTCATCTGCTTCGGCAAAACCTCGGTCCCAAAACAAGCTTTCTGCTTTCTTAGCGACAAATACTGCAAGTCCT
TCTCCATCGCAGCAGACAAACATTTCGTTGAAAAACGCTGGCAAGCGACCGACTGCCAATATAACGCAAAAAGTTCGCACGCCTACCACACCGGTGCCTT
TCCAGCCGCGGCATCGGATAGAGCGATCCACAGGTCGCGGAAACTACGTTCGCAAGCGTCAGACATATTGGGTTCATCCGAAACGTCGTCGTAGCAACTT
TAGCTTGGAAAAGAAGCGCAATGCGTTTATGCATGAACAACTTGAAATTAAAGAAGAACAACTCCGTCAACAGGCTGCAGGTGCTAGCAAcaagcaaaat
ttgattgTTCCAGGCGTGCAGTGCTACATTCCTGACAAGGATGAAGTGTGGCTGCTTTCAGAGATTGTTGACTATAATGATCGCCGAAAAGAGGTGACAA
TCACGGCTTTTCTCGACTCTGGTGATTCTGAGCAGCGCATTGTGGATCTCAAAAACCCGGACGTCATTCGTGCGGTTGCAGGACCCACAGCTACTGAAGT
GGAGTCGCTACCGATTGCCATTCTCCACGACAACCCTGAGGGTGTAGAAGACATGCGCCTTCTTCGATACCTGAACGAGCCTTCAATCCTTTTTAATTTG
AAGCAACGGTTCACCGCCTCAAAACCTTACACATACACGAACGAGATTGTGATCGCAGTAAATCCATACAAGTGGATTGATAACCTATATGGTGATCATT
TGCACGAGCAGTACTTAAAAAAACCTCGTGACTCACTGCCTCCTCACGTGTACTCAACGTCGACTGCTGCTTTCAAGCATATGAAGACTAATGCCATGAA
TCAGAGTATCTTGGTCAGTGGTGAATCTGGTGCTGGTAAGACCGAAACAACTAAAATTGTCATGAATCACTTGGCTAGCGTGGCGGGTGGTCGCAAGGAC
AAGACGATTGCGAAAGTCATTGACGTCAACCCGCTTCTTGAGTCGTTTGGTAATGCAAAGACGACTCGAAATGACAACAGCTCGCGTTTCGGTAAGTTTA
CACAGCTGCAATTTGACAGTCAAGGAAAACTAATTGGTGCCAAGTGCGAGACATATTTACTGGAGAAGTCACGTGTGGTATCTATCGCTGAAGGTGAGCG
CAACTACCATATATTTTATCAGCTTTTGGCTGGTCTGTCCGCAAAGGATCGCAAGGAATTTGGTCTGGACCCTGACTGTCAATACCAGTATGCTGGTGCA
CTTTCGGAAATGCAGATTCCAGGGCTGGATGATGCAAAGTGGTTTGCGAGCACGCAGAAGTCGCTGTCTATAATCGGACTGGACGGTGGTGCGCAGACAA
CGTTATTCAAAATTCTGGCTGGTGTTTTGCTACTGGGTGAAGTCTTGTTCGACAAAAGTGGTGAGAGTGGGTCACGCATATCAAGCGGCTCAGCACTGTC
TCAAGCTGCCAAGATGTTTGGCCTTCCAACCAAGAGTATCGAGGAAGCGCTGTGTAACCGCACTGTCATTACGCGTAATGATAGTGTCACAGTCCCTTTG
TCCCCTGTAGAAGCAGCTGAAAATCGTGATGCACTGGCTAAAACTATCTATTCAAAGATGTTTGACTGGATGGTGGGAAAAATTAATGGGGCTATAAGCA
CAGATGAGCGCCGCATAAAGGGCCAAATCGGTGTGCTGGATATTTTTGGATTTGAGGATTTTGCTCATAATGGCTTCGAGCAGTTTTGCATTAACTATGC
AAATGAAAAACTGCAGCAGAAGTTTACAACGGATGTGTTTAAAACTGTTGAGGAGGAGTATATTCGCGAAGGCCTGCAGTGGGATCACATTAAGTATCAG
GATAACCAGGGAATTGTGGAGGTCATTGAGGGCAAGATGGGAATTATTGCCCTCATGAACGACCATCTGCGTCAGCCTCGAGATACGGAGGAGGCTCTGG
TGAACAAAATTCGAACAAATCACCAGACAAAGAAGGGCGGCGAAGTGAACGAAAGTATTGACTTCCCTAAGGTGAAGCGTACGCAATTCATTATCAACCA
CTACGCAGGTTCCGTTACATATGAGACGGTGGGGTTTATGGAAAAACATCGCGATACGCTTCAGAAAGACCTACTTGATTTAATCCAACTGAGCAGTTTG
CCTTTGCTTCCAGAGCTTTTCGAGGACCCCGAAGTTCCTGAGGAAAGTAATGGGCGCGGCAAAAAAGCTCCTAAGAGTCTTGGCTCACAGTTTAAGACAT
CGCTGGCACAATTGATGGACAACATCAGGACGACTAATTCGCACTATGTGCGTTGCATCAAGCCTAACTCGAACAAGAGCTCGACTGAGTTTAATAAACG
CATGATCGTAGAGCAATTGCGTTCAGCTGGCGTGATTGAAGCCATTCGAATCACGCGCTCTGGTTATCCAAGTCGTCTTACCCCCGCTGAGTTAGCAACG
CGTTATGCTATCATGTTCCCGCCATCTATGCACAGTAAAGACGTCCGCCGCACGTGCAGTGTGTTTATGACTTCGATCGGTCGAAAATCGCCGCTAGAGT
ATCAGATGGGTAAATCATTGATTTACTTTAAAAATGGAGTAATGGAGGAGTTGGAGGCTATGAAGTCAGATTTTATGTATTACGAAGCGCGCACAATCCA
GCGGATTGCACTTGGGTTCTTGGAGCGCCGACGTTTGCGCAACAAAATTAATGCTGCAATCGTATTGCAATCATACGCGCGAATGTCATTGGACTTTAAG
GAGTATCATTTTCAGCGCCGGGCAATCAGGAAAATTCAGCGTGGTTGGAAAAAGTACAAAATGATTCCTGTCGAGCCTGAATACGACGACTATCGAGCTG
ATGAGTTCAACGATGGTGAGGAGTGGGTACATGGTGAAGACGACTCGGATATGGGCGATGATTTCGATAATGACCCGGCTTCGATCCGTGGAGGACGCGG
TAGGTCGGTCGTGGACCGTATGGAGTCGTTCCGAGTGGCCCATTCAGGTCGACGCGGCAGCGTCAAACGATTAAATGAGTTGTCGGCCCGTGCCAAGAGC
TTCATGAAGCCAAGAAGTGGTAGTGGGAGCACTTCAAGCTCGAGTGGCATTTCGTTGGAAGATGAAAATTCGATGCTCAAGATCGAAAATCGCAATTTAA
AATATGATCTGGAATTGATGCGTGAACAGTGCATCGAACTCCAAGCTATCATTCTTGAGATCAACAAAAGCCGCAAAAGGTAGAGAGTATGTGTCCGATG
CAGCTTTTTCTCGATGTGACTTCCAAATGGCTTTGGCCAGGGATCAAAAGTTATGAGTAAACGCCGCGAGGCGTATATCTGTCGCGAAAGACAACACTTT
TT