Description :
From Genome Similarity Track
Location :
Scaffold_431:7475- 10134
Sequence
2659 bases(100 bases per row)
TTGCGAGGCAAATTAGCAAGCCAAGGAAACAAGCAAGCTATGGAAAGGCCGATCGAGTGCATTGCACCATTATGATTATGGTGAGGAGCATGGTGTTTGT
GTGTGGCCTGCCGCTTAGCTTCTGGGGCGACACGGCCGAGTACGCGGCCTACATACTAAATCGAAGCCCTAACTAGCAAAGCAAAACCCGGTCGGCTATC
ACCTCTACAAATACTGACCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCGTGCACTGTTCGTTAAGACGCGA
GTAACAAGTCTTTTGGAGCTCGCGGTAAACAGGGCTTGATCATCGGCAAGACTGATGAAGTGATGGGGTACCGTGTTTACATTCCAGGGGACAAGATCGT
GGTCGCAACGCAACATGTCAAGAACGTTGAAAACTCAACGAAGGAGCAAAACGATCAACTACGGTGAGTTCACCCAAATGAAGCTAATGAAACTGCGAGC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGTGGCTGGACGCGAGAGACTCATG
TGACTAGGGCGGCGGCTAGAAAAATACGCGATGGAAATGATGAACGGAAAGTGGAGGAGCTTTCGCNNNNNNNNNNCTTTCGCATGCGGTGAACAGCATT
CGTGAGAGCGACCCGAAATCCTACGGGCAGGCCNNNNNNNNNNAGACAAGTGGGTGGTAGCGATGGATGAGGAGCTGCAAGATTTGGAGGACAACGGAGT
GTGGAGTGTTGAAGTGCCACCGAAGGGAAGTCATGATCTATATACTAAATGGGTGTTTAAAACCAAGATGGATGCAGAAGGAAAGATAGAGCATTTTAAA
TCGAGGCTTGTTGCCTGCGGGAACGAGCAGGTATTCGGTGTAGATTATGACTTGACGTTTGCTGCGGTGAAGGAGTTAAGTACGGTGAAGGTCATACTGG
TANNNNNNNNNNCGGAAGGATCGAGAGTTTTTAAGCGAGGATGGTTGCCTGCAGGAACAAGCAGGTCCTCGGTGTAGACAACATCTTGAAGTTTGCCGCG
GTGATGGAGTTAAATACGGTGAAGGTCATACTGGTACTTGCCCTTCGTTGAAGGTAACAGGAAGACAAGGTGACATACCTAAAGCCTACATGAAAGCAAA
CAAAAAGGAACATTTGGAGATAGTTCTTGCCGTATCACAAGGTTTAGTTGTAACAGATGTGACCTTGAAGCAACTTGGAGCTCAAGGCAGCGACAAACCA
GTGCTTAGGCTCAAAACGTTGCTTTACGGCCTTAAACAAGCCGGTTAGCTTTGGAGAAAACTACTGGACACGAAAATGGTGGAGGCTGGGCTTGTTCAAT
GCGTGTCAGACGCGTGGTCTGTTTTTCAACCACGACAAGGGCGTACTGACAATTTTCGGGGTATATGTCGATGATTTGTTGTAACAGCTTCAAGTAAGGA
CACTATGGAAGAATTCTTTGCAGCGATTAGTGTTCTCTCTATTATATACTTAGGTCAAGTTAAAAGGTTCTAGGTATGAGGGTGGCCTTGCAGTTCACAA
AGCGACGAGGCGCACGCACTAGCCCCGTGTCAGCAAATGGAAGTTGGCGAAGCGCGTCGCTAAATAACTGAAGGCAAAAAGACATGAAGCAAAGAAAGAA
GTTCTCACGGTNNNNNNNNNNNNNNNNNAAATATGGAGTGACTCAGACTTTGCATCAGACAAGGCCGACCGCAAGTCAATTNNNNNNNNNNNNNNNNNNN
NNACATACTGTAGCATCATTGTCTACCATGGAGGCCGAATTCACCTCGGCGTCNNNNNNNNNNCTTGACATTTCCTCGGTGATGAAGTTTAGTAAAGTGA
AGGTAAAGTTGATTCTTGCCCTACATTGGAAGGGGGGTACCAGCAAGACGCGGTGACGTAACTAACGACAACTTGAAGGAAAACAAAGAGAAACATTCGG
AGATTTTTTTTGCCGTACCACAAAGTATAATTATACCAGTTGAGACCTCGAAGCAACTTAAATGAAGTTCAAGGCAGCGACAAACCGGAGGTCACGCTTA
GAAGTCGCTTTACGGTCTTAAACAGCGGGTTGGCTTTAGATCCAACTACTGAACACAAAACTGAATAAGGCTGGGTTCAGTCAATGCGTGTCAGATACAT
GTCTATATTTCAACCTCGTAAAAGGCGAACTGATAATCGTCAGTGTATATGTGGATGCGTTTTGGTAGCAGCGTCACGTCGTGACAAGGTAGACGATTCT
TTGAAGCGATGAGTGTTCTCTCTATGATATATTTTGGTCAAGTTAACAAGTTCCTAGGCATGACGGTGGCTTTAAAGGACATTAAGACTTAAAATATTGA
TCAGACCGCAGCGATCGAAGAGATGCTGAGTCACTATGGTATGTATGAAGCAAACGGCGTGGTGACGCCAGTTTTGGTGACGACACCAACGACCAGGAAG
CGCCTGTGAACCTGTCAGAAAAACGGGGCAAGAAGGTGGATCAACTATCCGATACTTTCAGTCATTGTTCGGTAGCCTTATAGGGTCGTCAGGTGTTTTA
AGGCCTGACGTTAGCTTTGAGGGACACATAGCCATCAGACGCACGCACCAGTCTAGTGT