Description :
From Genome Similarity Track
Location :
Scaffold_66:7475- 8946
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-fgenesh-gene-0.7DEAD/DEAH box RNA helicase

Sequence
1471 bases(100 bases per row)
CACGGCCGCCATGCCACGATGGCGCACGTCGTCTGGGCCGGCAGCTTCAAGACCAGGCACATCGAGCAGATTCATCTTCTTCAGAATCTTGTGCTCAAGC
TTGGGGACTTGTGGTagACCGATCGACTCGCTGTACTCCTCGGCCAAGCTGGCGAGCTGAGGCTTCGAGATACCGAGACGGCGGAGGTTCGAGTTGTAGA
ATCCCAGCCAGGCCTGGTACGACTGTCTCGCAGACTTTTCGAGCTCTCCATCTTCAGCGAGAGTGGTGATCGCTTTCGCTGTGCGACTGTTCTCAGGAGT
AACGATCTTGGTTGGTGGGAGCTCGAGCTGTTTtATCGGCAATCCCTTGAGCTCGTGCAAGAGTGGCTTCTCAAAATCAGCAAGTACGAGAATGCCATGA
CCCGCCGAGCCAGCACGGGCTGTACGACCAAGACGATGGATGTACTGATCGCGATCGGTGAGACCAACCTGAAGGACCAGagTAACATCTGGGTAATCGA
CACCACGCGCCGACACATCCGAGGAGAACATGATGACACGCTTGGATGTGCGGAACACCTCCGCCGTCTTGGTACGCACCGACTGGCTCTTTCGCGAATG
CATCTCCAACACTCCCTTGAAGCCAGCTGCTGTGAAAAGCTGAGCCATAAAGCCTGCTGAACGGGCAGTGGGGAAAAATACCATAATCTTGAAGTCGCGG
GCATGAgaCGCCATGTGCATGTTCAAGATGCTTTCGACCGTCGCGACCACATCAGTCTCTGGGCATACGAGGTATTCTTGCTGAACTTGGACGTTTGTCT
GTGCATCaTCTTCGCTAACTGTGTTCACGAGTTCGAAGTCCTTGCGAAGCGCAAGCTTGGTCAACTCTTGGGtGgATTtCGgAAGAGTCGCACTAAaGAG
TAGCGTTTGGCGCTGAGCAGGCACGCTGTTTAGGACCTTGACTACTTCGTTGCGGAAGCCCATATCCAGCAGACGGtCTGCcTCATCCAGcACCaGAAAG
CGGAGTTTGCGAAGCATCTTaTTGATACTGCCGGCGTCTTGCTGTATCAGATCAAGTAGACGACCGGGGgTCGCAACCACAATGTCTACTGGCTTTGGAC
CTGTCAGAATCTTGGTGTCCTTGTGAACGGGCGTACCACCAACAAAGCAAGCGACTTGCATGTCGTGAAACTGAGCAATCTTGCGTGCCTCTGTGGCGAT
CTGTTGCGCCAGCTCTCGGGTTGGTGAGATGATGAGCGCCGGGATCGCGTTTGGCGTGGAGTCGAGGCCCATCCGcACCATGCGTTCAATCGTCGGTAGC
AAGAaTGCCATAGTCTTACCATTACCAGtCTTTGCCTTGGACAGCACATCCTTGCCGGCcAAGATATGCGGGAACGTCTTGGCTTGGACGTCCGTGAGGA
ACTCGTACTTGAGCTCCTGtcGGATGgCGCGCTTCGAGTTCTCCGTGATCTCCAACGACGCGAAGCGCGTC