Description :
From Genome Similarity Track
Location :
Scaffold_170:7475- 8542
Transcript NameFunction/comments
Phypl_g4636type II inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
1067 bases(100 bases per row)
ACGTGTCGTTCTCCATGAATGTACGCACGTCGCTACCGCGGGTACTGCCGGGGAAGTCGAGGCGCGTTCCGGTAGCGATCTTGCCCGCGGTCTCGCGCCC
TGGAGCAAGTGTTGTCGGAATAAGGTACTTGGAATTGGCCATGTTGACGCCTGTGGTGGGGAGCACGCTTTGCGGCGGCACGGAACGGAACgcctgcacc
accagctgcacGCTCTCACTGTCGCTAGCAAGGCTCGAGGACGATCCGGTCCCAGACGGCAGAGGCCCACCAGGTTCTCCAGCTTTCTGTTGCTGCGGCA
ATGGGTTGTTCCCGGCGAGCGAGTccctggacgacgtgctgcgctcgGTCACAGCTACTGCACAAGGCGCTGACCCTAGCAACTGTTCATCAAGCCGACA
CCGCCCCACGCCCAGAGTACCCTGCACGTTCCCCGGACTCTGCGTAAGCTGCGTCTTACACAACGTGAGACGCAGCTGCTCATACCGTTCCAGCTCCGCA
GTCAGCACAATCGAGAACGGCACTGGGGCCTGCTCCCCTGCTGCCCCCGAGGCCGCTCCGCACGCGGTCACCAAGGTCGTCAACTTCACGACATCCGTCG
AGCCAAGCTCCACGAacgtcttgctgctgcggatgtATCCACTGACCGCAACGAAACAGCCCGTGCGGTCTTTGTCCTTGTCCGCAGCCGCAACGTGCTC
CACCGAGCGAGCCAATTTGCTGCGCCTGCCCATGAGCACGGAGATCGACAGGTCGTACATCCGGCGTTGCGAGCCAGTGGCATTTTCCTGTGCCGCCGAC
CTGGTggagccgctggcgctgctggccgtgagTCGCTGCGGGTTCtgcctccgtctccagctccgctcGATGTCGTCAACTGCGCTGGTCTCCGTCTCGT
CCCAGTGTtgcgacgacgcgctcgcctCCAAAACATCCTTTTCAGTGGGTCGGAAGGTGGTTGCGGTCGTCCCTcgcaagagcgacgagcgGCGGCCGTC
GATGGTACCGGAAAAACTCGACATGGACGTGTTGACGGAGAATTTCGAGGCGCGGATGGCGTCTGCC