Description :
From Genome Similarity Track
Location :
Scaffold_79:7472- 9854
Transcript NameFunction/comments
Physo_139822reverse transcriptase

Sequence
2382 bases(100 bases per row)
GAAGCACGCGGACGTGCTTCCGGAAGAGACCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGT
GTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCC
CGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGATACCGGCGCAGAC
ACCGATACCGCGAAAAGATGCCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCAATGGGTTCTATCAGATCCTCATGCGT
GAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCAAGCAGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCA
ACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGTGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACAGGATGAGTGA
TGTTGAGATGTACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAG
ATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTAATCAATGAGTGGCCGACGCCGTCGAACGTCAAGG
AACTGCGGTAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAACTCCTGAAGAAGGACGC
CGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGAGGCGCCGGTCTTGGCGGTGGCCGACCAAGATTGCCCG
TTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGTAGCACGATCACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGCGTC
AGCTGAAGCCAGCTGAGCGCAACTACCTGGTGCGTGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCAGAGTGTATCTACTCGGAAGCAA
ACCGTTCGTGGTCTACACAGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAG
TATAACTTCCAGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGAAGCCGACGTCAATG
CCATTGACGCCATGCGATCGAGCACCTCAATGTCGTCACTGTTGGACGACGTGAAGGCCGCGTACGCGCACGACGCCGATGCGAAGCTCTTGCTGGCCTA
TGGCTCAGCACCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCTCGATGGGTTATTACTCTACAGT
GCAGTCGACGACAACGCGTTCCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATC
CGGGCCGTGAGAAGACACACCTTCTTCTCACACGAGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCA
ACGTGTGAAGCCTGCGCCCTTCGCGCGGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTT
CCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGGAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGACAC
AGACGGCTCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCAATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCA
AGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGAC
GTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGACTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGCGCATGCCTCGACCGGGCATA
CACCGTTCTACGTGAATGCCATCAGGCACCCACGCCGCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGGGA