Description :
From Genome Similarity Track
Location :
Scaffold_440:7472- 9108
Sequence
1636 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACCTTAAACTTCCGTTGTGACCGGGATGTACTCGTGGATAATGGTAGCTCGTCGTCGAGGATTGCTTC
GACTTCATACTGGTTCATACTTGTGTCTGGCTCCCAGCTATCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCCAGGTCGGCGATT
AGCCTCGTCTTTGGTCTTCCGTCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAAAACCTGTACCCACTCTTGTCGGGTAACTCCA
ATTCATAGGCGAATTCCTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTGCATAAA
CAGCCAGACTTGATCTCCCTCTTTGAACAAGGATTCGGTGGATTCATCGCCTGTTTCTGCAACTCCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTT
TTCTCCTTCTTGCTCAGTGCTTCGTTGTGCTCTCGAGCTCGTCGTGCCTTCTCTCGCACTTGGAACCCAGCTGCTAATCGAAGGGCAACTTCTCGTTGTC
TGTTCGCTTCTCGGCACCACTCGACTGCGTCCGCTGAGCTGGCTGAGCGTCCCTGTCCACGTCGTATTGAGCTCGTCATAGACTTGAGTGTAGACTTTGC
GTCCCAACCATGTACCAGATAGAAAGGGGTTTCTCGCCGAGTAGAGTCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGATTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAACGTAG
CTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTG
CCTGAAGACGCATTCTTCAAACACCTTGGCCACTTCAAGTGCCCCGGTGTCAATTATAGCCTTAGCGATAACGAATTCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGTAGGGGAATCACGAAATCCATTGACACGACTTGAAATGGAAGGTCTGACACCACATTTCCCGGCGAGT
AACCTCTCAACTGCAGCTTACCCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCGGC
CTTGACTCGGTGATAAGCTCTGACGATGCCTTGATGCCTCACGTCGATCGAGTTGTGACAGTTATGAAGTATCTCGTCGACCATATTGACGGAATCACCA
ATCTCAATGCGAAGTTCGGGTCGCCAAGTTCGCCCAGTCGGCGAGTTTTATCTCGGCGGTATAACAGGCCGTCTTCGTTGAGTACAAAGACTTCTGCGAC
TTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAACTTACCTCTCAGGTACGCCTTCAGATCAGCCCACCTGAGTTCTTCATCTTGTGCCTTC
GCGATTCGTCGTCTCCGCTCAATCTGTACTGTCACT