Description :
From Genome Similarity Track
Location :
Scaffold_1223:747- 2663
Sequence
1916 bases(100 bases per row)
CGCTGCTGCGAGGGTGGAAGAAATCGCCCCGGTGGTTTGCCTTCTTCTACAAAATGCGGTCAGCAAGAAATCTGCTGTCACGGCTGAAACACTGGCAAAT
CATCACGAGCAGATTGTCGATCGCATCATCGGCCTGAACGGCGCCTCCGCTACTCGCGACATCGGCGATATTCTTGGCGGCATCGTACCAAGCGCCGAAC
TCCCGCAAGGAGATGCCCATAGTGCTTGGGTGGATCCGTTGACGGACCAGGATACGAGTATCCGCCTGCAGCACGTCATCGACTTCGTTTATTATGTTGA
TGGCGACCGTCCGATACCGCGGTCAGAGCGGTCACATATCGGGAGCACCTTCACCGATGATCCTCTGACTCGTCCGATCCGAATTCCGGCGTCGAACAGG
GTAAATCGTTCCGGAGCTCCTCCGACAGGAGTCACGGATAACACAACCCTCGATGCACTGCTCTCCTCTCTCGACGAGGATGAGTCCGCCGATAATCCGT
CGTTACCGCCAATTCCATCCGCCGAGGAACGCGGGCCGTCGATGCACTCGAAAATTATCGCCGCTCTTTCCGATCACCCGGATTTACTAATACATTACCT
TTCTGAATCCGCTACAGCAGCGCAGAAGCGTCCAGCTGAAGGTGAGGCCCCGGGACGGAATCCATCTCCGCCAACAATCCGTCAACACCACCCGGCAATT
TCCGATCTCTTGCTGCTCGAAGAAGGCGTCAGATCACAGCCGAAGACAAGTTTCCGTCCGACCACTGAGCAGCTGGCGATTCATTCCCATATTGTGGCCC
CCGCGCTGACCGGTAAGCAGCCCTGTGCCTTTATTGACCTCATTATTTCGTCCGATTCCGCGTCGTTCCCGCCCCACCCCGCGATCCTCACCCGGTTATT
CGACTTTCGATTTGGTATTCGGGGTCTCTCGCTTGCGCATCTTGAACTGCTCGACAGCCGTCAAAAGCGACGATGGCCACATGACTCGGGCGTCAACATG
GACAACTTCTCTGCATCTGTCAACATTCCGAAACCAAAACCGTTTGCCAGTTTGTTCGACCTCCAATCAGCGCTCTCTGTGCTTAACACGTTCGGGCGGA
CATTTTACAACCAGTTGACATCCGATTTTATACTCGCTGGTGTTAATTTCGCGGCGAGCCTTCATTCCATGGGACCATGGAATTCTTCGGACATTGAGAC
CTTGACGTTTTGGTTTGATTCAGTGCTCGAACACTATCGCCGTTCAGTGGAAGACTGGGTGGCCACTGGGAATGATGAACGGGAGGTGATCAAGGCTCAA
TTCTCCAAGGCCAACCCCGACTTTTTGGGTACTCTCCATGTGATTCAGAGTGAACGTTTAACGTCCATCTACCAGAGCGACAGGCAGCGGGCAGGAGTTC
AACGGGAACCAGCTCGACCTAGTCGCTTCGGCACCCGACGTCAAAACCCCGAATCTCGGCGCAACAAGGTCCCTACAGAGGTGATTGCTGTCCTGCCGCG
ACAGGGTGCGAAAACTATCTGTCTCAAATCATTGTCAAACGACCAATGCCAGTCAAAGAGCACAAGCAAGTGCATCTTCGAAGGACGGTTCCACATTGAC
CCTAAGGACCTTAAATTGTCCGATCTCAATCCACTTGTGGTCAAGTACATTGAGCAACACTTGGGCGGCGTCAATCCAACTGCTGTAACAACAGCTTGAC
GCCAGGCCGCTACCGACCCTCACTCCGGCTTTGCAATCTCTCTTCGTGTTGTGCGTGATATACAGTTTAAATTGGAGCAAGAGTTGTGCTATCAAGAGGC
CATTCGCTCTCAAACATTCTACGCGGCCCTGGACGCGGCGTTAATTACGAGACCGAATCGGTCATCAACGATTACGCCTTCACCTCCAGCTAATAAAGCA
TTTCGCCTGGACCACG