Description :
From Genome Similarity Track
Location :
contig_23:746793- 752563
Transcript NameFunction/comments
g5237.t1hypothetical protein PHYSODRAFT_351206
g5238.t1arginine N-methyltransferase
g5239.t1hypothetical protein

Sequence
5770 bases(100 bases per row)
CGTTGCTTTTGCAAAAAGGTGAATATCCCATTGAAGAGGCCAACTCGGTCTTCATCACCAGCGACGATAAAGGTGAAATAGCAAAGCAATCGCCTCGCTT
CGAGTGCCAGACCCCCCCACCCCGAGCAAATCAGTTTGTACTCACAGGGGGGGGGGTAATTTGTACTGGCTACGAAAAGTGCAAGGTTTTTCTCATAATA
AGGTCGAGATTAAATGTTTTAATATTTAATATTTAAAAAGTAGCCGCGTAAGTCTTAGGAGTAAAACTGTACGGTAGCTTAAACTGGGACACGTGCTTCT
TCGTGGTAAAAATCGTCTCAGTCCGTCAGTCGAACAAGCGCTTCTTGGGGCGCCATGGTGCACAGCAGCAAGTATGACCTGCTCATCAAACTCCTGCTGA
TCGGGGACAGCGGTGCGTGTAGTCTCCGCCTCCTGTCGCCCTTCTGCCTGCCTTTAACGACCTTTGTGTTCCTCTTTCTGCCTCAGGCGTGGGGAAGAGC
TGCGTGCTCCTGCGCTACTCGGACGACTCGTTCACGACTTCCTTTATCACCACCATCGGGTGCGTCTTGACTGGGAGTTTGTATGCTCCAGTATAGCTGG
GGACTGACGTTGTGCTGCAGCATCGACTTTAAGGTGAAGACTATCGACGTGGACGGCAAGCGGATAAAGCTGCAGATCTGGGACACTGCGGGTCAGGAGC
GCTTCCGGACGATCACGACGGGTGCGAGCTGGGTCTTACTTGGTATACCTATATTTTATCACGTGTCTGACTGGCGGTGTGGTATGTGGGCAGCGTATTA
CCGTGGCGCGATGGGAATTCTGCTGGTCTATGATGTGACTGACGACCATTCCTTCCAGAGTGAGTTGGAAGTGCTATTTTATTGTGTCTATGTGGGAACT
ACAGTAACAGCTTTTGTTTGGTGGATTGTGTTGAAGATCTGACTTTGTGTTGTTTATCTGTGGTGTCGGGCAGATATTCGTAACTGGATGACACAAATTC
GACAGAATGCGTCCTCGAATGTGAACAAAATTCTCATCGGAAACAAGTGCGATGTGGATCCGTCGGAGAGAGTACGTTGAAGGCTGTGATGTGATGTATG
AATGTGCTGGTTCTGTGACTGATGTGCATTCTGGTGGTGCTGGCTGCTATCAGGCGGTAACGACGAAGCAGGGCCAGGACCTCGCGGACGAGTTCGGAAT
CAAGTTCTTCGAGACGAGCGCAAAGAGCAACAAGAACATCGACGAGGCCTTCCGCTCGATCGCTGTGGACATCCAGAAGCGGCTGGCGGAGAGCGAGCAC
GATAGATTAGACGTGGCGAACGGCAGCAAATTCCGCGTGGACGAGTCTCAGGAGCAAGCCAAAGACAGCTGCTGCGCCTAGTTGTCTCTCGGTTGCCCTC
CCTCTCGCTGTTGCTTGTCTTTCGTCTCGTTTATCCCGAGTGAGTGGTTGACACGCCTTACATGAGTCGACACGAAGTAGAGCTCAGCAGCGTGCAGGAC
GAGCAGCCAGCTACCGGATGCGAATAAGTCTATCATAAATCTCTTGCACTTACATCTTTCAACTGGCAATGAGCAGGATTATCAGGTGATATCTAAAAGT
GTAGCCATGTGTCACAGGCCAGTCGTTTTTGGTTGGCTGGCGGTGCATTTGCCAAATTGGCGAGCGGACATGGCGGAGTGCGGCGACATCGTGGACGGCG
GCGAGACGTGGGACGACTGGGTGGACGACGGCTCGTCCGCCAGCTTCGACTGCGTGTTCTGCGCCGCCAAGTTCCCGGCGGAGGAGCCACTGCACGCGCA
TCTGCAGGACTCGCACGCGTTCTCGCTGCGCCGCGAGGTCTCGACGCGCAAACTGGATACGTACGGCACCATCCAGTTCGTCAACTTCCTGCGCTGGAGT
ACGCTGGACGGCGCCTCCGAGGAGCAGGTGAAGCAGACGCTGGCTACCGAGGGCAGTGCCGCCTTCCAGAAGGACGAGTTCCTCAAGCCCGTGGTGGCCG
ACGACCCGCTACTCTACTGCCTCGAATGCGACAGCAGCGACGACGAGGACAATGAGGACAATGAGGACGAGGAGCAGAAGACCGACAAGGTGGCTGTCCC
CAGTGCTGGAGATGAAGCTAGTGACCTTATTGCCAAGCTGAGACTGGAGAACCAGGAGCTCAAGCAACAGATGACCAAGTACTCGAAACTCGTCCGCGAC
TTTGTGGTGGATGGCGAAAGCGCCGCGCCCGTTGAGGACGCTGCCGACAATGACACGTACTACTTTGACTCGTACTCGCACGTGGGCATCCACCGCGAGA
TGATCACGGACAGAATCCGCACGGACGGCTACCGCAACGCCATCATCAACAACCCGGAGGTGTTCAAGGGCAAGGTGGTGCTGGACGTTGGCTGCGGGAC
GGGCATTCTGAGCATGTTCGCTGCACAGGCCGGCGCTGCTAAGGTAATTGGCATTGACCGCAGCGAAATGGGCGACGTGGCTCGCGAGATCGTGGCGGCC
AACGGATTCAGCGACGTCATTACGATTCTCCGCGGCAAGGTGGAGGACATGGAGCTGCCGGTGGACAAGGTGGACATTATCGTCTCGGAGTGGATGGGTT
ACTGTCTCCTGTACGAATCGATGCTGGACACTGTGCTCTTCGCGCGCGACAAGTGGCTTGCCCCGGGTGGACACCTGTTCCCGGACAAGTGTTCGATGTT
CATCCAGGGCATGGAGGACTCGACGAATCGCTTTGCCTTCTGGGACGACGTGTACGGCTTCAATATGCAGCCCATCAAGTCCAAGATCTCCATTCGCGAC
GCGTTTGTGGAGGACGTTCTGCCGAGCGACATCATCACGAGCCGCGAGTTGCTGCAGAAGATCGACATTGATCTCGTCACGTACGATGAGCTGGACTTCC
ACTCGACTTTCACGTTGTCTGCAACGAAGGACGCGACAATGCACGGATTCGTGTCCAGCTTCGACATTGGTTTCGAGCGTGACTGCCCGCGTCCTGAGTA
CTTTACGACGGGAGCCGAGGGCACGCCGACACACTGGCACCAGGTCTTCTTCCACATCCCGAAGCCTTTCACGGTCAAGAAGGGAGACGCCGTTGAAGGC
AAGTGGTGGGTGCGGCGAAACGCCGAGAACCCGCGCTTCCTCGACGTTGAGATCCAGTGGAAGCAGACGGCCGAGGGCGAGTTCCTTGTTCAGCGCTATC
GCATTCACTAGAGTTTTTAGCGCACAGACGCTGTAACATTTGCTTTGAATTTTTTCAGCTTATTTTTTGTGCTTTGTGCTTTCAGCCACAGCGTAAGCAC
TTTTGGTGGAAGAAACCTCTTCCTTTGGCTCTATGAATGCAGCTTGACTTGGCTAATGACGTCCTTCACCAGAACAGACATCGCCTGCACCTTCTCGAAT
TCCTCGCCAGTGGGCGAGATCATGGCCAAGCACTTGAGCAAGAGGTAGTGAGTGGAAGTGAGCGATGGCGTGAGATCGAGGTTTTCTACCAGGGGTCTGA
CACGAGAGGTGGCTGAGCATCATTGATCACCCACGAAAACACGTCCGCACGCAGCATACTCATCACCACAGCGTACTCCGCCTCGGTCTTCATTCGCCGC
AGAATAAGCGAAAGTCGAGCTCGGGCAATGGCTCCTAGCTTGAGTACCAGGCGCTCCGGTTTCTGCATCTTCTCGATTGCTAGGTCGGCCCGTTCGTCCC
TCCCGGACTGGTACAGGAACAACACGTACTCTTCACGGATTACATCTAATGGCAATCCGAACGCTTCTGTAAGCGCGAACCCCAATGTTTCGTCATGTCG
GAGGAGTTCCTTAAAAACCTGGTGCGATCTCGGTTGATCCATTTTAACTCTTCTTCACTCGGCTGGGCCAGTGCTGGTGTTATTAGGAAGCTGTCGGGGC
GGCACAAGCATCGTCCACTGTTCGAGAACAGCTTCACAATCGAGATTGGCGTCACCGCCGTTGCAGCAAAGGAATCGAGCAGCATAATCAAACTAATGTG
GTCTGCGATCTGCGACGTCGAGATCATATCGAACTTGAAGCTCTGCAACGTTAACATGAGCGAAGACGTATCATGAGAAGGTGGCCATCGCTGCCTGAAG
ATCAAGTGAAGATTCTTCACACGACACCGCCACTTGACTGACTGCGTCAAGCTATCCATCTTGAATGCAGTGATACGTAGTACATCGTCATCATCGTCAG
ATTCAACATCTGCATCACTTGTTTCATCATCGTAGTCCTTTTCAACATCACCATAAGCTGTTTCAGTTGATCGGGTCGCTGAGATAGCCTTTACAGCCGC
CGATAACGTGACAAGAAGGCTCCGGATAATACCGAAAAAGCGGCGGGCAACTTGCGGCTGGAGGCCACGTTGCGGCTTCTTACCAGCGGCACTTTCCTCC
CAAAATGTGATTAAAGTCACCACGTGCACACGGATGTATCGCTCCCAAATATAAGCCGTCATGGCCGCTTTCACTTGAAACGAATGCACGCAATCAAGCT
CGAGCAGCGCATTTTCGAGCTGGCGCATATCTGATCGCTCCGCATTCCAAGCGGTGCAGAGAATTCCTACCCGAAAGCAACATAGAGAATCTTTGTCCAA
AAACTGTGGATACGCGCGCAGTACAGCTGCCCAATCCTTCATCTGCGCAGCCTTTCGGCAGTTCTCCATTGTCGCGACCCAGCCATCTGTGCCATCACTG
CTCACATTGGCCTCGACACGATCCCCAGGTATTGCACTGCAGCATCATCTTCGCCGGCCTCGTGGCCATCATTAATTTGCATGACAGCTAGACTCCGCAT
AATCTCATCCACGTGCTCAACTGCGTCGACAGATAACCGACCAACTTTCCCAAGACGCAACGACATGTGAACCGTTTTCGCGATGCAATCTTGCAAAATG
ATCCAGCGTGTCCCGCTACCCGTGCTGCTGTACTTTCCGAACGTGTCTTCTTCAGCATGCTTCGCTGACTGTTTCTCTCCCCACCCACAGTGTTCACTCA
GCACGAAAGCATGGAAAAGCTTTGGCGTCTTCCAGCACGAGTTAAAGATTTCTGCCAGCGAGCGGGGACAATCGCGCAAGCGGCGCAGATAACTTTCTGC
AGACACAAATGATGCCTCAGCATTGTCTTCCCCTCTTGCTCTATTGCCGTCTCCACATCTCCGATGACGAAGTACGGGTCTAGCCAACGCTGAAGAGATG
AAGACATTGATGGAGGAGGCAGTGCGAGTACTGCACCGAGAGGGAGTGAGAAGTACCACTCAATAAATAGTCTTGTAAGTGTATCTTCCGACAAGAAGAT
AGCCGAATGTAGTTGTTGCAGCTCCTAACCAAGTCGGAAGCAAGTTAGATGTTTAGTATCAAGCATCGCCGGAATCCAAATGATAAGCATACCTGAACCG
CGAAGACACTTGACAGCACTGGTGCGAGAATAAACGTAACGAGGCAGTCTCTATGAGCTGCAGTCGAAAATTTGCGGAAAATCGGAGTCTTCAACACACG
AAAACTTTTGCGCAAAAACTCCTCTTTCGTTTCAGCAATCTCAAACAGAGACAGAATATCTCGACGACGGGGTAACTCAGGATCGCTGAACGGCATCGAG
AAGAACTCCATGAACTCCCACGCAGTGAGCTGGCTAGCGCTATCGATCGCTTTACGTGTTCGGGCACAGGATTCGTCGTCCAGCGCAAGACCAGCGCGAC
GAAAAAGTTCCAACCACGGGAAGATTCGCGGTCCTGACTGCTTCTCTTTTGCACCGGAACGAGAAATGAT