Description :
From Genome Similarity Track
Location :
contig_34:74652- 76530
Transcript NameFunction/comments
g6574.t1hypothetical protein
g6575.t1hypothetical protein MAA_00416
g6576.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
ATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGT
TGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCAT
CATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCA
GCTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGGAGCACACTGAACTGCACTGCAG
TGATCGCCTTCGTCATCATGTCCGCCAGCATGTCCGTTGTCGACACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCG
AATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCC
ATCTCGCCGAGCTCACACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCTTCCGTCGAAGACAGCGCCACCG
TCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGC
ATCCGAATATCCGCACATACCAAGGCTGTTCTTCCCGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGAGGGCTTG
CCAATGCGTCGGACACGGGTCGGCAGAGAACTGGCTCAGCACTCCCACTGCAGCAGCCAGGTCCGGACGCGTTGCCACCATCAAGTACATGAGAGCACCG
ACGGCACTCCGATACGGCACGTTCTTCATCGTGTCTTCATGCTGGCAGCCACCCTCACACATGTTCTTGGTCAGCTTGAGTCCGGGTCTTGCGGCGTCTT
CACAGGCTTGCTGTCTTGCATGCCGAACTTGGTCAGGATGGACTTGAGAAACTTGGTCTGCCGCACCGTCACTTTTCCGGAGTCGCGGTCGTTCTTGATC
TCCATCCCGAGGAAGTACTCCAGCTCGCCGAGGTCCGTCATCTCAAACCGCTTGCTCAACGCGTGCTTGGTCGATTCCAACAGCTCGTCGTTGCTGCTAG
CGAGGACCAAGTCGTCAACGTAGAGCGCCACGAAGATCATGTCTTGGCCGTCACGCTTCAGGTAGACGCAGTGGTCGGACTCGCACTTCTTGAACCCCAG
CTTGAGCATGAAGTCGTCGATGGTCTGGTTCCACATGCGCGGCGACTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTGCACACGTGGTCCGGGTGGTCT
TCGTCCACATAGCCATCCGGCTGTGCCATGTAGATGTCTTCGTCCAGCACACCGTTGAGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAGACCAT
ACTTGGCAGCCAGACTCAGTACGATCCGGATCGACGTGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTT
GGCCACCAGTCGCGCCTGAACCGCTCAATCTCTCCAGCTTGGTTCTCACGCGAAACACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCGGTGGTACGAC
ATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGACTGCGTCGCTGGATTC