Description :
From Genome Similarity Track
Location :
Scaffold_281:7465- 10057
Transcript NameFunction/comments
Albla_Nc14113430

Sequence
2592 bases(100 bases per row)
GCCCAAATGATGCGCCAAGTTGAGAATACTTCCGAATAAGCATCCCGCGGTGATTGCAGCATCTGCTACCGGTCCTGTGATCACAATAGGATGCGTGGCA
TGTCGCCGAGTAAAGAATGAAATGCCACATTGTCCTGATTCGAGAGAATGCATCGACTGCTTCCTATCGATACTTGCTACCTGAATTTTGATTTGTTTTA
GCGCGACGTCAATACAAACAATGACCCCAAGCGTCTCCTTTTCCAAATGCGCTTGTTCCAATCGTTTCTGTAACATACACGACGCCTTCATTTTCGCACG
AAAATGCTCGTAAACCTGTTCATAACTCCGTACAGCCGTATCGACTTCAAAAGGTGGACTCACTTCCATCAAGCAGGGATCGATTTCTACTTGACTGAGA
TCCAACCGCACATCCAATTCTCTAGCTAGTAAAATAGCTTTCTTTGCACACAGTATACCACTGATATCTTGCATAATTTCATCTGCACGCATACGCGATC
GATAGTGCTCAAATTGTTGCTGGAATAGTTGTAGAGTCTTCTCCACGGAAGAATGATCATTAGATAATAAGAAATCGGTTAGAAACTGAGTCGCTGATAG
TTCGACTCTCTCCACAGAATCCCCAGTCTCAATAAAGTTTCGGATCGTTCCAACGAGCGGGACTCCAATCGCTAGACAGGCCTCTGTATCGAACACAACT
TCGCGTGCAGCCATCTTTTCCTTCAGTTCTTGATGCAATTTGCTCGGATATGCGGCTACATTAATATTCGCGCTGACGACATGCACACCAGCGTCCAGCC
AAAGCGAATAAAAGTCGGGTATATGAGAAGCGTGATGACGAGAAACATCCACGAGGAGCCAGTGAGGAATATGGTCAGCACAAACGTGTTTTAGAAATTT
AGCGTGGTCGAATGCTTCGTATTGTGAGGAAGCTTGCAACATTTCAGCTGTGATACTTTCGCTGGAGCATAGAAACATCCGGTAATCAGTGGTTGTGACA
GCACGAATACGAATGTCCACATTGCTGATGGCTTTCAAGTGCTTGCGTTGCTGGTAGTACTGTTCTAATAATGCATTGCCAATACCGCCTTCCAAATCAC
ACTCTAAATCGAGTCCCATTACTCCAATTGAGATAGTCTGATCCGATAGAAAAAAAGCTGAATGAGCTGCGCGTAAAGCTGCAGCAGAATCTTCGTATCG
AACCACAGCCGATGTGTTCCGTTCCGAGGATCCTTGTGAGATAGCCAAGGTATTGATTCCTGCACGACCTAATGCGCTGAAGAAACGACCTGAAACTCCG
GGTGTTTGTGTCATATTATCGCCCACAGCAGCAATAACGCTTACGGGAGATACGAATTCGGGTTCATTTAATAGTCCATGATGAATTTCCTTGAAGAAAG
CCTCACTCACAGCATTTTTCACTTCCTTAGCGCATTTCGCTGGCACGGCAAAGCAAATGGAATGCTCTGAACTGGCTTGTGCGATCAAGACAACGTTCAC
TTTTGATCGATCCAAAGCGCTGAACAAACGTGACGAAGTCCCATGAACACCAATCATACCCGCTCCCTCAATGTTGAATAGAGCCAAATGGTCGACAGTT
GAGAACCCGCTAACAGTATGCCGCGCGACTTGGGATCGAGATCTCGGTCGATCTTCTTTTTTTTCTCTTCCGTGAGTGATTTTAGTGCCCAAATGCGTCG
GATGAAATGTGTTACGAATATAAATTGGGATGGATTCCATGATGGCTGGTGTCATTGTCTTTGGGTGGATCACTTTGGCGCCAAAGTATGCGAGTTCCAT
GGCTTCTTGGTACGAAATCTCATTCAGAATTTTGGATTCGGGTACTCGTCGAGGATCAGCACTAAGCACACCCGATACATCAGTCCATATGGTGATGCTG
GAAGCATGCAAAAGCCGTCCACAAATGGAAGCAGTAAAATCGCTTCCATCCCGTTTCAGCGTCGTCATGATCCCATCGACGGTATTGCATATAAAGCCTG
TAATAACGATATGATCCATCAACCCTGCACCGTCGGAATGCTGCAAAAGTGAATTTAATTTCTCTTCAGAAAGTTCATACTGAACAACCGGACCATGATC
TGAATCGATCTCAACTGTTAGAAATCTTCGGGCGTCAATATATTCGTATCGGTGATGACTTTTGGAAGACTGATTCAAGATCTCTGTCAAGATTTTAGCA
GACCATATCTCACCATGTCCTGCGATGAATTCCATTATTGTCTCAGTGAACGACCTCATGATCGTAATGGCACGCAAAAGCTCAGATAATTGAAGGATAT
CATCATTGATATCTTGCATCAGACGAGTGGCAATCTCAGGTGGAAGCAGTGTTATCAGTATGTCTTCATGTTTTGTACGAAGTGTTATTAAAATGGCTTC
AATTTCTTCCTGTTTGTCTGCCTGAGCACAATCGACTAATTGTATGAGCAAATCCGTTACTTTTGGGACGCCACCAATTGCTGAGACGACGACAGCGATT
TTGGGACATTCCAATGATGTCACAATGTCAATGACATTTGTGATGGAAGAAGCATTTCCGACAGATGTTCCACCAAACTTGTGAACGACAAA