Description :
From Genome Similarity Track
Location :
contig_75:74618- 76349
Transcript NameFunction/comments
g11782.t1XP_009529862.1 hypothetical protein PHYSODRAFT_505512 [Phytophthora sojae

Sequence
1731 bases(100 bases per row)
TCAACCGCCCCTCCTGGTCCAGATCCATCAGAGAGGAAATATCCCGAGCTGGCGAATCATGGCCAGGACATTCAAACGGGAGCCAACCCAAGAAATCGAA
TCAAACGCTGCCGTTGCACTCTGCCGTCTGCCAGAATTCAGCGCATTGCCGTACCCTGTCTCTCCAACGGTCGGTCACGATCCATCTTCAATGTTCTCCT
CCCGGATACCACAGCATTCACGTGCAATACGCGGTCATATCGCGATTTCCCAACTTGTAACATGGCGGAGACCGCAACGCCCGGCCCAGCGCCTTCCTCG
ACGCCAGCGGCCAGCGGCGACAGCACACAGCCTCCTCCGGATTCTGCTTCTCCTCCAGACGCCGGCGACGTCGAGAAGCGCCCCCCAGAAGACTCAAGCC
AGCCTTCAAGCGGCGAGTCTCAGGCCATCATCCTGCGTCAGCCTGATGGTGACGACAGCGCCGAGAACGCCCCAGATGCGAGCGAAAATGCTGGTGGCAG
TGGCGTCAGCCCCATCCCGATGGGCGAGGGTGTCGTGTTGCCTTCCTTCTCGCGACCACGCCACGTGCGGATGGAAGACGTCGACGCGCTATTCTTCAAG
GGCGTCCTATCGCAACAAACGATTCGTCCCGAGAATTTTGCTCCTCCTGACTCTTCGGCGCGCTGGACCTTGCCTTCCCTCCAGACACCGGCACCAAGAC
ATACTTGGTGGGTTCCAGCCACGGTGGACGACACGCGCGGCGGCGGCTTCACGATGAATGGATACGGGGGCACTACAGCATTGATTGGCTTCGAAGAGAT
GAACGCGGACGACAATTCTGAATTCGAGCGTCTGTTTGACATGAATGCCCGTCAGTACCTCCTGCAAGCGCGACAAGATCCGCTCCGGCTGGATGCCTTG
ACCTCCAGTCTGGACGACATTGGCACGCGACGTGAATTCGCCTCGATCCTGACTCACTTTCCTCCGGATCAACTCGCCTCGCGTGTCTTCCGCACTTCGA
TGTATTTGCGTCTTGTTCTGGGTGAACATCGTCGACTTCGGGCGCAGATTGAGCGTGGTCAGGAAGCCGCGATTAAAGACGCTCTGGAGTTCAAGCGCAT
CAATGGTGACCTTCGTCGTGAATGGAAGTTCGTCTGCGCACACTGGCACCAAGAGGTGACTTCTGCACTTGCCAAGGCCAACGAAATCAAGGCCTCTGAC
CAAGACGAAGTCCAGGCGTTGAAGTCTCGATACCAAGACCAAATCGACGCGCTTGAGGCTGAGAAGTCCGAGTTGAAGGCCCGTGTCGACGACGCAGAGA
CTCAAGTTGGCATCCTGAAGAAGCGTCTGGACGATAGTACCATGGATCCTTGGACGCTGTCCGCCTTCATGCAGAAGCACGCTGACGTCTCCGGCAACTG
GGATCGGCTGCATGACTTGTTTGTGCACTGCGTGAATGGCTGCGTTCCTCCGTCTGCTTGGGACACCGTCGTCAACATCACGGCTATGGATCAACGCAAG
GCTCCAATTCCAACGTTTCCTGCGTCTCGTCTGGCTGTTCCAGTTCCCAAGCCTCCGGTTTCGAATCCTGTCATTCTGGACTTAACCAGTCCATCTGGCA
TTCAGGAGTCCAAGCCGCATTCTGGTGACAAGTCTTCGCAGAAGTCGCCTACTCCAAAGTCACTCAAGAAGACCAAGTCTCCCAAAGTCCAGAGGCGACC
ATCGACTCATCACCCAGGCCGCGACTCAGTG