Description :
From Genome Similarity Track
Location :
contig_43:74614- 76492
Transcript NameFunction/comments
g6320.t1hypothetical protein PHYSODRAFT_341336

Sequence
1878 bases(100 bases per row)
CTATGAACACGCTCGAGAAGAAGGCGTTGAAAATCCGCTCCGCGCCTTGGAAGTACGGGAACTGGAGCCACATCATCACTAGCAGCTTCACGTGGTAAAA
CAGCGGGAGCCACGCGATCTCTCGTCCGATCGCTGCGATCAAGTAGTCCGCAGTGACAGCCACGCTGAAGTAGGCGAGCCACCACTCGTAGCGCCGCGTC
CGCTTTTCGCCTAGCACTCCGATCGTGACGTAGGCGGGGAAACCAAAGCCCATCAGCGAGCAGCCACGAGAGGCCACAAAGCCTGGCGTGAACATGAAGA
GGAGTCCGAAGAGCGCAGGACCCTGCGACCACAGGTCCTTGGCCAAGTGCACGTGCTTCTCCGGCACCACGCGGAGCGACACCAGCAAGCGCATCAAGAC
GTTTGCCCTTCTCTTCGCCTTCTGTGTTGATCGGCTCTCGCTCGTGAAGTCGATTGGCGTAGGGACTGATAAGCGGACTCAGCAGCGTGTAGAGCGCAAT
GTCGCCGCGCGTGAACGGAGAGTGCATCCACACGAGGAAGATGTTGCAGAAGTGGAGCGGCACAGTGAAGAAGGACGTCACAAACGCCGGCAGGAAGAGC
GTCACCATGCCGATCAAGCACGCTGTGAGTGACCAGATCACCCAGTACTTCAAGCAGGCCTCGTACGCGCGCCACTCGTAGTCCGGGATGCCAATCTTCT
CGAACTTCTTGATCAGTTCACTGGTCGGTCCTGGTCTTGACGCCGGCGGAGTGGCTTTGACGTGTTTCGGGTACAGCCTCTTCTGTCTGATGACCCCGAT
TGAGTGCAGCAACGGGTACCCCACAGACAGCAGTCCAAAGAGTGTTTCACTGCTCAACACGTCCGTCGTAGGCTCTGGTAGCCAATCCAGCGCCTCAAGC
TCAGCGCAAAGAAAGCACGTGGGGCAGGAGAATGGCCACTATGCGCCACTTGGCGCTTAGACTCGCGACGAAAGCTCTGTACCGGAGCTCCAGCAGCCTC
CGCGTCCTTACGTACTGCAGTCTGGCCTTGTGCACATACCCCTGGCGGATGCAGACGGCCACTAAAAGCCCCGAGAGCGCCAGAATGGCCTGGTGCACAG
GGTCCATCCTGCCACGTAGTCGGCCCCCATCTTGGCCACTGCAATGACATGAGGCAGCGCCGCCTCGCCCAATAAAGCCAGCAATTGAACCAAGGGCACA
GCCACCAGTAGCAGGAAGGTTCCCCATAATTGCAGACACTGGAACGTGGCCACGACGGCGTCTTCCAGTGCGAAGCCGATGGCGCTCCAGTCCGGACTCT
GCGCGAAGACTTGAGCGACGTGGGACGCGTTGAATGGACTGGAGAACAGGTTAAGAGGCAGGTACTGGTCCAACAGCCCCTTCGTGTAGGGCAGCGCGTC
CTGCTAAATCCACGAATTAAGGGAGAGACGTAGGAGTTAAGGGAATGTTGCAGGAATTACGAGATAAAGAGAGACTGAGACGCGTACAGAGAGGATGGGC
ACGGGAGCTTCAAGTGAGGCAGTTGCAAGAGGATCTTCTTGCTGGCCATTCAGCTGGACGAAGAGCAGCGGCCCTAGAATCAGCGTCACGGGGAGCAGCA
CGCGGCGCAGCATCGTGGCGACGAGTCGTCGGTTTGAATATTGGATATGTCACAGGATAAGGTCATTATAGGGAGGGGATATATGTGACGTGTGAACACT
TTTGGATTGTATGTGGACGAGTCTCACACGTCGCAGATTTGATAAACGGAGACTTCAACAGTATTCAGGATCCAGGATTGGTGTTGAGCGTAGGATAGCG
CTAGGTTGGCATTCACAGTGGAATCAATACAACCTTAAGAGCTCCCAAGCATCTTCAAACTCAACAAGCCGTAGGAAA