Description :
From Genome Similarity Track
Location :
Scaffold_591:7461- 8483
Sequence
1022 bases(100 bases per row)
TCAAGACCAGCAACCCTCAATACTGTTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCTCCCGAAAGGCGCAGACGATCGCC
GATTCTTACGAAGAGTGCGTGTTCCGGCGATTTGGTTCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGTTTATGGCTGACTTCTTCCGCGCCTTTAA
CAAGATCCTGGGTATGCGCCAGCGAGCGACGATCGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGATACAGACGGCGACGAGAGCCCTGAAG
ATGTTCGTGGAGGATCTGGATCAGAGGGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAAGATCGGGTCCGTGGGGACTCCC
CTTTTTATCTGGTGCATGAATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACTCGGACTCGGGATCGGGATCCTCGACGGTGGCG
TTATCGGATCCAGAAGCACTACGATCAGGCACGAAGTCAGGTGAATGCTCGACTACGCGAGGCGATCGCGGATCGGGCCGATCGACACAATGAAGAAGTT
CGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCATGTGAAAGAGGGGTATGCCCGGAAGCTGGCTCACCTGTGGCAAGGCCCGT
TCCGTGTGGCGGAGAAGGTGAACGAGTACACGATGAATCTTCAGATCGCTGGTACGGACTATCACCTATTCCCGATCGTGCATGTTTCGAAGCTGAAGTT
GGTCAGGGACTTCCCCGATCGACCGCAGATCGCACTCACGGTGGACGAAGCAGATCGACTCGATTTCGACGAAGTCTTACTTCCGGAGGACAGCTGGGCC
CCAGATCGAGACTCGAACGAGTACGAAGTGGAGAAGATCACGGATATGCGGACGGGTCGAAGGACGCGGTACGGCCGGACTTATCGAGAACTCCTGGTAC
ACTGGAAGGGTTACGACGAGCC