Description :
From Genome Similarity Track
Location :
Scaffold_780:7460- 8921
Sequence
1461 bases(100 bases per row)
AGAGGCAACGACGAGAAGGTAAGTGCTATTAGTATTATCGTTTAAACGGAGTCCTGATTGACAGTATTTGATTCTTCAACACGATACGTCCTGCAATAGG
GGTAATTTTCTTGAAATACTGTCGTTTTTGGCTCAGAGAATGCCAGATTTCGCGGATTTGATGAACTCTGCCGCCGCAAATGCCAAGTACACATCTCCTA
CAGTACAACAAGAGCTTATTCATTGCGCGGCGGATGTAGCTCATGAATATATCGTGGAGAATGAACTTGGACAAGGGTATTTTGCACTCCTAGTATATGA
AGCAACATGTGAAGGTGGAAAAGAAAACATGGCTATTGTAGTCCGGTTTTTATCCAGGCATACTGGTGAAATTCGAGAACGTCTTCTGGGTTCGGTTCAC
GTTCGCGATACCTCTTCTGAGTCACTTAAATCTGCGTTGATAAATCATATCACAATTTGGAGAATAAATATTTCTCGGTGCCGTAGCCAAGGATACGATG
GGGCTTCAAACATGTCCGGTGGATATAATGGGCTACAAAAATTGATCCGAGATACTTGCCCGTACGCTTACTACGCTCACTGCTTCGCTCACCGCCTTAA
TCTTGCAGTAGTGACTGCATCAAAACAGACTGTCTCTGTGACGGAATGCTTCAACATCGTTCAGTCTATTCACGGTACTCGTAGTGCATCATACAAAAGG
AAAGACGGTTTGTCTGGTTACGCGCAAGACGAACTACAACAACTAATCAGCAGTGCTTATCTGGAAACCGGTCGAGGTTAAAACCAGCATCTTGCAACTC
AGGCTTTAAGTGCCATGCGCTGGAATTATCGTGTGCGAGCTTTATTACGTATTAGATGGTTGTGGACTCCAATTATTAAAGTATTGAGGCGCGTGGAATT
AGATGGAGCCAATCTTGACAAGCGAGCTAATGCAAAGGGCATTATTACAGAATAGCAAACATTTGATATCGTTTTTCACATCGAAATTATCATAGTGGTA
TTGGAAAAAGTAAACATTTTGTCTCAATATCTACAAAAGGATGACATGGATATAGCCTCGGCTGCAGGACTAGTGAGACAGACGCAAACTTTATTCAACA
ATATGCAAGCTAACAAACTAAAAGACGACGAAAAGACTAGTTTTTTTTTACTGTTTGGGCTACTGCGGTAGCATTCTGCACATCATTACACGACCCTATC
AACGTACCGGTCAAAACAGCACCGTGGTCACGAAGGGGATTACGTAACAGGGGAAAAGAAAAGTCTGGTGTCCCCGGTGCGGATCGAAATGAGATTGTCA
CACAAGAATTTCACTATTATGAAGACGTGTATTTAGCTGTGGTTAAAGGAATTGCTGGTCAATTAAAATGACGATTTAGTGGAGACACTTCTTGATCTGA
ATGGAGCTTTGCGAAGATTAAACGCCTCGTAAAAAGTTTCATTTATTGGAAACCCTGACTC