Description :
From Genome Similarity Track
Location :
Scaffold_138:74595- 75700
Transcript NameFunction/comments
g18588.t1XP_009513783.1 hypothetical protein PHYSODRAFT_320443 [Phytophthora sojae
g18589.t1RAW34120.1 hypothetical protein PC110_g9556 [Phytophthora cactorum

Sequence
1105 bases(100 bases per row)
TCGTTGCCGGTATCAAGGAAGGATTGAGCGAGTAAGTGTATTCCATCCAGCAAGGTAGTCAGGTATCCACCGCTGCACAGCTAGAAAGGGAAACAACAAA
CAAATAGAAAAAGGCAAAGAGGTATTCGTGTGTGCTTCCAAGTAGGTCCATCGGATATCTACATGTGGTGGCGCTTATGCGCGGCTTCCTCCTGCAGTAA
GCGAAAGCCCCGAAGATATTGCTGGCACTGCGCGGCAGTGTCTGCCTGAAGGTCCAGAGTGCGGCACGGGTGCACGAACACAAGCGAAAGGCAGCGTGTT
GGTGCATCAGGTCGCTGACGGGCAAAGGTCTCAGTGGTTGCACCCGGTAGCACCTCAACCAAGTCGCACGTGTCTGCTTTGGCGTCAGCCTTGGGCTGCA
TTAGCGAGCCGTGGGTGACTGACGTCGCAGGCGAGCGCCATGACAACCAGTGGCATTGTGCATCTGAATACACGACGCGCTGGTGAGGCACTCCTCGGGC
TCCGAACTTGGTCACCACAATACCGCTCTCAAGTTGTCGCTTGAATTGAGCCAGAAACTCGTGCTCCTTGGCCTGTGCTGCAGCGCGAGATTTGCTGGCG
CTTTCGAGCTCATCGATCGTTGCTTGCAGGTGAGTCTTCTCCGTGCGTTCGTTCTCACAGCGCTGTTCGAGCTCACGTATTTGGCGCTTCAGATCGGTTT
GCGTGGTTTGAGCGTCTTGCTCCACCTTCTTTCGGACAACCTCGAGTTCAGCACTGAATTCGCTGCGCATGACGCGCTCACGAGTTTGCGCCTCTCGCAG
GTTCTCGTGGAGCGAAGCTAGCAACTGCTTGCTCGTCGAGTTTACCAATTCCAACGCGTGCACTTGCTCTTGGAGCTGCTGTAGCTGCTGCTCGTGGCAC
GAGAACTCTGCCAGCAGCTCATCGCGATTCTGGTTCAAGTCGAAGTTACCGTCTTTCAATCGATCATGAAGCGGCACGGTTGTCGCTGCTGAATTTGGCT
GATCTGGTGGCGGCAACGTTGGTGACTGCTGAACTGACTGAACTGGCTGAACTGCTACGGGAATTTCAGCGGTAACAGGAGGATCCTCCTCTTCTACTGT
AGTGC