Description :
From Genome Similarity Track
Location :
Scaffold_76:74553- 77882
Transcript NameFunction/comments
Phypl_g2534hypothetical protein

Sequence
3329 bases(100 bases per row)
TCTTGCCCCCAGTAAGCGCGGGTAGAATCGTGAGAGCCATTGATTGCCGAGCCGCAGAACCAGAAATCTCCTCCACATCCAGCGAAGACGAATTGAGCCG
ACATGGCGCCGAAGAAGGggaagaagaacgccaagaagaacgcgggcacggccgccgcctcggacGACCTCGATGACCTGCTGAACGAGTTCGCGCCCGC
GGGGGCCAccaagccgcagccgcaggagcagtcgccgcaggaggacaagacggAGGAACagacgcaggagaaggagtcggacgtggacgccgccgccgcc
gcgtacCTGGCGTCTCTGGGCGTGTCCCCCGCAGCTGGAGgtgagaagaaggacgacaagaagaagaagaagaagggcaagaagaagcccaatGCCgaca
ccaagaaggacgacgacaagaagcccatgtcggcggcggccaaggcCCTGATGGAGCGCCAGGCGGCCATgaaggcggagcaggagcgcgtcgagcagga
gcgtctggagcaggagcgcatcgcccaggaggaggaggccaagcgcctggccgacgtcgagcgcgaggaggagacccGCCGCAAGAAAAAGGAggcgcgc
gccgccaagatcgagcgccagaagaaggaggGCACGTACATGACCAAGGcccagaagcagaaggcggccaaggccCAGGCCGCCCTCGAGGCCATGCAGC
AGGCGGGTCTCGTCCCCGAGGCTcccgccgagaagaagaaggtcgtgTACTCgaacaacaagaagaagaacaagacgaagaaggagcccAAGAAGGTTGA
GCCTCAGCCCGTGGTCAAgggagaggaggaggaagtggAGGATTGGGAGGCTGCCGAGGACACCGCTGAGgcgcaggaagaggaggccgaggcccCCGAC
GCGTGGGACGACGAGGACTGGGAGACCAGCGACGTTGTGGCCTCGCTcgaggacaagctgcaggaggtcaaggaggaggccgcaGCCGAtgagagcgaca
gcgacggagACGAGGATCTGCTGTTGCTagagcagaagaaggagcaggaaCGTCTGCGTCAGCAGGGCAtcgcgctgaagaagcgccaGGAGGAGCAAGC
CGAGCAGATGCGTCTagaggccgaggaggagcgtcAGCtctcgaaggcgaagatggAGGCCGATCGTAAGAAGAAAGAGGCAGCTGAGCGTCGTCGCGAG
CGTGAGGCTGCCGCGCGTGCCAACGTGTCCCTGGACAACCTGCGTTCACCCATTTGCTGTATCATGGGCCACGTCGATACTGGTAAGACGAAGCTCCTGG
ACAACATCCGCCGAACCAAGGTGCAGGACGGCGAAGCTGGTGGTATTACCCAGCAAATtggcgccaccttcttcccTGTGGAGGCTATTAAGCAGAAGAC
AGCACGCCTCGCCGAGACCATGAAGCTGGAGTACCGCCTGCCCGGTCTTCTTGTGATCGATACGCCCGGTCACGAGTCGTTCACGAACCTGCGTTCTCGT
GGTTCTTCGCTGTGTGATATCGCCATTCTGGTCGTTGATATCATGCACGGTTTGGAGCCGCAAACTctggagtcgctgcgcctgctgcgtcGGAAGAAGG
CCCCGTTTGTGGTGGCGCTTAACAAGATCGATCGGTGCTACGGCTGGAAAGCGATGCCCGACATGCCCGTCCAGGAGGCTCTGAAGCACCAGAACGAACA
CGTCATTCGCGAGTTCGAGGACCGCATGAAGGCGATCATTGTGGAGTTTGCTGAGCAGAAGCTGAATGCCGAAGTGTACTGGCGCAACACGGacttggcg
cgcacggtcTCGCTCATCCCTACCAGTGCTATCTCGGGCGAGGGTGTGCAGGACTTGCTGATGATGCTGACGCGATTGACGCAGGAGCGCATGGCCAAAT
CGCTGGCGTTCGTTGACATCCTGCAATGTACCGTGCTGGAAGTGAAGGTCATTGAGGGTCTCGGTACGACGATTGATACGATTCTGGTGAATGGTACTCT
GGAAGAGGGTTCGACTATCGTAGTGTGTACATTGGACGGCCCAGTTGTGACAACGATCCGTTCGCTGCTGACTCCGCACCCCATGAAGGAAATCCGTGTC
AAGGGCGAGTACATCCACCACCAGAAAATGAAGGCCGCTATGGGCGTGAAGATTTGCGCGCAGGGCCTTGAGAAGGCCGTCGCCGGTACGCAGATTTACG
TGGTGGGCCCCGATGACGACGTtgaggagctgaaggactCCGTCATGTCCGACTTGACGGGCATTCTGGATTCCGTGAAGGCTACTCGTCGCGGAGTTAT
GGTTCAGGCTTCCACGCTGGGTGCCCTGGAGGCGCTTCTGGAGTTCTTACGCACGTGCGACCCGCCCATTCCGGTGTCCTGCGTAAACATCGGCCCCGTC
CACAAGAAGGACGTCATGCGTGCGTccgtgcagctggagcaccagCCCGAGTACGCCACCATTTTGGCGTTCGATGTGAAGGTCCACAGCGACGCTACTG
AGCTGTCTGCGGAGCTCGGCGTGCGCATTTTCACGGCCGACATCATTTACCACCTGTTCGACCAATTCACGGCGTACATGGACAACTTCCGAATGGCCCG
CCGTGAGGAGTTCGCCGAGGTGGCCGTGTTCCCGTGCGTGCTGAAGATCCTGCCCGAATGCGTCTTCAACAAGAAGGACCCGATCATTCTCGGTGTCGAC
ATCGAGGAAGGTATCCTCAAGATTGGCACGCCGCTCGTCGTGCCGTCCGCCGGCGGCTTCCTGGTCGGCAAGGTGGGCTCcatcgagcgcgagcacAAGG
AGGTGGAccgcgccaagaagggcgCGTCCGTGGCCGTGCGGATAGACAACGAGGGCAGCGTCATGTACGGCCGCCACTTCGACCACAAGAACAAACTGGT
GTCGCGCCTGACCCGCCAGAGCATCGACGCGCTGAAGGAGAATTTCCGGGAAGAcctgcagaaggaggacTGGCAGCTCGTcatcaagctcaagaaggtg
tTCGATATCATTTAGAGCGCGCGAGCTATGCGCAAGAAAAGCGGGGAACGTTCGCGCCCAGACAGAGGGTGTCAAGAGGAGACTCCTGTTGAGATCAGAG
CAGGTTTCTCGCCAGTTATGGTGCTAGCAATATATGGTTTTCGCTCATATTTTCGTCGACATGCAACAGCTCACGCAGGGTAGAGGATGGAGTTCAgtcg
cgtccagcgcggTGATGATATCGCGTCCTGGTCGCCGGACCTGGTCGCTGAACGCCGCTgcgcgctgcgtcttgagccCCATTCCAACCGCGCACGTCAT
GGGTCCGTCGTAGGTGGAGTCaagcctcg