Description :
From Genome Similarity Track
Location :
contig_23:745344- 754692
Transcript NameFunction/comments
g6171.t1hypothetical protein
g6172.t1hypothetical protein
g6173.t1RAW35223.1 Protein arginine N-methyltransferase 3 [Phytophthora cactorum
g6174.t1hypothetical protein
g6175.t1ETI45689.1 hypothetical protein F443_09831 [Phytophthora parasitica P1569

Sequence
9348 bases(100 bases per row)
TTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGT
GGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGAT
AGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGC
TCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGA
GCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGC
GAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACG
TAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAAC
CCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCA
CTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCA
GCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGC
TTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAGAACCAA
ACGAAGCTTTGGTGGTAAATGAGAACTGTATTGCTTGTAAATGGGGTTTCCTCCTAAAATTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGC
AGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCTTTGGGCTATGAATGTGGACCACCTTGTGGTGGTCA
CCTGAATGTATCCCTTAGTGCAACATGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTATAAAAGCAGTGTCCAGATCAATAACAGAGACGAG
CGCTTTCTACTTCACTAGCTGTTTCGCCCTTAAGATTGAGTTTTTCGTTCCCTGTATCCAGCGATTGTATTGCACTCCCTGCACGACTTGAGTACATGTT
GAAAAACCCAAGACGGGAGTAGGTATTTCAAGGGCGCGCCGCAAGTTGCTCCAGATAAGTCGGGGTGAAACAGCACTTTCATCCATTCGTTGAATGTATT
CACGCATCTCTCGTGTCACCATCGCTGGTGATTTCTGAGAGCACTCTGCGCTCCCACGAAAATGCCATTACAATTACTGTGAATGACCCAGCGCAAATAC
GTTGAACATTCATGAATTTTCCAGACAACACTGCACTTTTGGGGCTTGGACACTTCTAGGTAGTTCGGGATTCTACATCGTAGGCGACGCTCAACCATCT
CGTGGCCTCCAAGACAAATCAAACACCAGCGCGTCCTCACCCAAAAGACAGCAGAGCAGCAGAAGTTTCACTGCGAAACTTCGTGCTAAATTCGGCCAGC
TTTGCCCAGCTCTGCTGAGGAGGCGTCGTATGTACCAAGGCGAATGCTTGAAAGAAGATGATGCGCTCTTAAATCGCTCCCGACATAATGTACGCGCCAC
AGGACGCGCGCTGGAAGTAGACCTTCACCTCAGCAGCTGCCTGCGCTGCACAAGAAAGACATCGAGAACGCGCTCATGTCGGATACTCTGCTTGTCCGTA
GGCTACTCGTTCTTGTCGACGAGCGAAATGATGCAGAAGCTGCTGCGCTACTCGATGGTAGATGGGTGGCTGGTGTCAGTAGCCTAAGGACGATACTAGT
AATGGTTCCACCGTATCGCGTGTACACGACGGAGAATAAAAAGACAAAACAGGTTGCGAGCGACCAGAAATGTTGCTGCTAGCGATCGGTTTCCGACAGT
TGAGTCTTTTGGTGGTTGCTGGCGCCCCGAAATGTTCGTTGTTGAGCTAAAGACGATAAACTGGCGAACCGGACTTGTCGCCGTACGGCCTGTGGAAGCC
TACCGGGTGCGCTGTCAAGTCAGCGCACGTTGCTTTTGCAAAAAAGGTGAATAATCCCATTGAAGAGGCCAACTCGGTCTTCATCACCAGCGACGATAAA
GGTGAAATAGCAAAGCAATCGCCTCGCTTCGAGTGCCAGACCCCACCCCACCCCGAGCAAGATCAGTTTGTACTCACAGGGGGGGGGGGTAATTTGTACT
GGCTACGAAAAGTGCAAGGTTTTCTCATAATAAGGTCGAGATTAAATGTTTTAATATTTAATATTTAAAAAGTAGCCGCGTAAGTCTTAGGAGTAAAACT
GTACGGTAGCTTAAACTGGGACACGTGCTTCTTCGTGGTAAAAATCGTCTCAGTCCGTCAGTCGAACAAGCGCTTCTTGGGGCGCCATGGTGCACAGCAG
CAAGTATGACCTGCTCATCAAACTCCTGCTGATCGGGGACAGCGGTGCGTGTAGTCTCCGCCTCCTGTCGCCCTTCTGCCTGCCTTTAACGACCTTTGTG
TTCCTCTTTCTGCCTCAGGCGTGGGGAAGAGCTGCGTGCTCCTGCGCTACTCGGACGACTCGTTCACGACTTCCTTTATCACCACCATCGGGTGCGTCTT
GACTGGGAGTTTGTATGCTCCAGTATAGCTGGGGACTGACGTTGTGCTGCAGCATCGACTTTAAGGTGAAGACTATCGACGTGGACGGCAAGCGGATAAA
GCTGCAGATCTGGGACACTGCGGGTCAGGAGCGCTTCCGGACGATCACGACGGGTGCGAGCTGGGTCTTACTTGGTATACCTATATTTTATCACGTGTCT
GACTGGCGGTGTGGTATGTGGGCAGCGTATTACCGTGGCGCGATGGGAATTCTGCTGGTCTATGATGTGACTGACGACCATTCCTTCCAGAGTGAGTTGG
AAGTGCTATTTTATTGTGTCTATGTGGGAACTACAGTAACAGCTTTTGTTTGGTGGATTGTGTTGAAGATCTGACTTTGTGTTGTTTATCTGTGGTGTCG
GGCAGATATTCGTAACTGGATGACACAAATTCGACAGAATGCGTCCTCGAATGTGAACAAAATTCTCATCGGAAACAAGTGCGATGTGGATCCGTCGGAG
AGAGTACGTTGAAGGCTGTGATGTGATGTATGAATGTGCTGGTTCTGTGACTGATGTGCATTCTGGTGGTGCTGGCTGCTATCAGGCGGTAACGACGAAG
CAGGGCCAGGACCTCGCGGACGAGTTCGGAATCAAGTTCTTCGAGACGAGCGCAAAGAGCAACAAGAACATCGACGAGGCCTTCCGCTCGATCGCTGTGG
ACATCCAGAAGCGGCTGGCGGAGAGCGAGCACGATAGATTAGACGTGGCGAACGGCAGCAAATTCCGCGTGGACGAGTCTCAGGAGCAAGCCAAAGACAG
CTGCTGCGCCTAGTCGTCTCTCGGTTGCCCTCCCTCTCGCTGTTGCTTGTCTTTCGTCTCGTTTATCCCGAGTGAGTGGTTGACACGCCTTACATGAGTC
GACACGAAGTAGAGCTCAGCAGCGTGCAGGACGAGCAGCCAGCTACCGGATGCGAATAAGTCTATCATAAATCTCTTGCACTTACATCTTTCAACTGGCA
ATGAGCAGGATTATCAGGTGATATCTAAAAGTGTAGCCATGTGTCACAGGCCAGTCGTTTTTGGTTGGCTGGCGGTGCATTTGCCAAATTGGCGAGCGGA
CATGGCGGAGTGCGGCGACATCGTGGACGGCGGCGAGACGTGGGACGACTGGGTGGATGACGGCTCGTCCGCCAGCTTCGACTGCGTGTTCTGCGCCGCC
AAGTTCCCGGCGGAGGAGCCACTGCACGCGCATCTGCAGGACTCGCACGCGTTCTCGCTGCGCCGCGAGGTCTCGACGCGCAAACTGGATACGTACGGCA
CCATCCAGTTCGTCAACTTCCTGCGCTGGAGTACGCTGGACGGCGCCTCCGAGGAGCAGGTGAAGCAGACGCTGGCTACCGAGGGCAGTGCCGCCTTCCA
GAAGGACGAGTTCCTCAAGCCCGTGGTGGCCGACGACCCGCTACTCTACTGCCTCGAATGCGACAGCAGCGACGACGAGGACAATGAGGACAATGAGGAC
GAGGAGCAGAAGACCGACAAGGTGGCTGTCCCCAGTGTTGGAGATGAAGCTAGTGACCTTATTGCCAAGCTGAGACTGGAGAACCAGGAGCTCAAGCAAC
AGATGACCAAGTACTCGAAACTCGTCCGCGACTTTGTGGTGGATGGCGAAAGCGCCGCGCCCGTTGAGGACGCTGCCGACAATGACACGTACTACTTTGA
CTCGTACTCGCACGTGGGCATCCACCGCGAGATGATCACGGACAGAATCCGCACGGACGGCTACCGCAACGCCATCATCAACAACCCGGAGGTGTTCAAG
GGCAAGGTGGTGCTGGACGTTGGCTGCGGGACGGGCATTCTGAGCATGTTCGCTGCACAGGCCGGCGCTGCTAAGGTAATTGGCATTGACCGCAGCGAAA
TGGGCGACGTGGCTCGCGAGATCGTGGCGGCCAACGGATTCAGCGACGTCATTACGATTCTCCGCGGCAAGGTGGAGGACATGGAGCTGCCGGTGGACAA
GGTGGACATTATCGTCTCGGAGTGGATGGGTTACTGTCTCCTGTACGAATCGATGCTGGACACTGTGCTCTTCGCGCGCGACAAGTGGCTTGCCCCGGGT
GGACACCTGTTCCCGGACAAGTGTTCGATGTTCATCCAGGGCATGGAGGACTCGACGAATCGCTTTGCCTTCTGGGACGACGTGTACGGCTTCAATATGC
AGCCCATCAAGTCCAAGATCTCCATTCGCGACGCGTTTGTGGAGGACGTTCTGCCGAGCGACATCATCACGAGCCGCGAGTTGCTGCAGAAGATCGACAT
TGATCTCGTCACGTACGATGAGCTGGACTTCCACTCGACTTTCACGTTGTCTGCAACGAAGGACGCGACAATGCACGGATTCGTGTCCAGCTTCGACATT
GGTTTCGAGCGTGACTGCCCGCGTCCTGAGTACTTTACGACGGGAGCCGAGGGCACGCCGACACACTGGCACCAGGTCTTCTTCCACATCCCGAAGCCTT
TCACGGTCAAGAAGGGAGACGCCGTTGAAGGCAAGTGGTGGGTGCGGCGAAACGCCGAGAACCCGCGCTTCCTCGACGTTGAGATCCAGTGGAAGCAGAC
GGCCGAGGGCGAGTTCCTTGTTCAGCGCTATCGCATTCACTAGAGTTTTTAGCGCACAGACGCTGTAACATTTGCTTTGAATTTTTTCAGCTTATTTTTT
GTGCTTTGTGCTTTCAGCCACAGCGTAAGCACTTTTTGGTGGAAGAAACCTCTTCCTTTGGCTCTATGAATGCAGCTTGACTTGGCTAATGACGTCCTTC
ACCAGAACAGACATCGCCTGCACCTTCTCGAATTCCTCGCCAGTGGGCGAGATCATGGCCAAGCACTTGAGCAAGAGGTAGTGAGTGGAAGTGAGCGATG
GCGTGAGATCGAGGTTTTCTACCAGGGGGTCTGACACGAGAGGTGGCTGAGCATCATTGATCACCCACGAAAACACGTCCGCACGCAGCATACTCATCAC
CACAGCGTACTCCGCCTCGGTCTTCATTCGCCGCAGAATAAGCGAAAGTCGAGCTCGGGCAATGGCTCCTAGCTTGAGTACCAGGCGCTCCGGTTTCTGC
ATCTTCTCGATTGCTAGGTCGGCCCGTTCGTCCCTCCCGGACTGGTACAGGAACAACACGTACTCTTCACGGATTACATCTAATGGCAATCCGAACGCTT
CTGTAAGCGCGAACCCCAATGTTTCGTCATGTCGGAGGAGTTCCTTCAAAAACCTGGTGCGATCTCGGTTGATCCATTTTAACTCTTCTTCACTCGGCTG
GGCCAGTGCTGGTGTTATTAGGAAGCTGTCGGGGCGGCACAAGCATCGTCCACTGTTCGAGAACAGCTTCACAATCGAGATTGGCGTCACCGCCGTTGCA
GCAAAGGAATCGAGCAGCATAATCAAACTAATGTGGTCTGCGATCTGCGACGTCGAGATCATATCGAACTTGAAGCTCTGCAACGTTAACATGAGCGAAG
ACGTATCATGAGAAGGTGGCCATCGCTGCCTGAAGATCAAGTGAAGATTCTTCACACGACACCGCCACTTGACTGACTGCGTCAAGCTATCCATATTGAA
TGCAGTGATACGTAGTACATCGTCATCATCGTCAGATTCAACATCTGCATCACTTGTTTCATCATCGTAGTCCTTTTCAACATCACCATAAGCTGTTTCA
GTTGATCGGGTCGCTGAGATAGCCTTTACAGCCGCCGATAACGTGACAAGAAGGCTCCGGATAATACCGAAAAAGCGGCGGGCAACTTGCGGCTGGAGGC
CACGTTGCGGCTTCTTACCAGCGGCACTTTCCTCCCAAAATGTGATTAAAGTCACCACGTGCACACGGATGTATCGCTCCCAAATATAAGCCGTCATGGC
CGCTTTCACTTGAAACGAATGCACGCAATCAAGCTCGAGCAGCGCATTTTCGAGCTGGCGCATATCTGATCGCTCCGCATTCCAAGCGGTGCAGAGAATT
CCTACCCGAAAGCAACATAGAGAATCTTTGTCCAAAAACTGTGGATACGCGCGCAGTACAGCTGCCCAATCCTTCATCTGCGCAGCCTTTCGGCAGTTCT
CCATTGTCGCGACCCAGCCATCTGTGCCATCACTGCTCACATTGGCCTCGACACGATCCCCAGGTATTGCACTGCAGCATCATCTTCGCCGGCCTCGTGG
CCATCATTAATTTGCATGACAGCTAGACTCCGCATAATCTCATCCACGTGCTCAACTGCGTCGACAGATAACCGACCAACTTTCCCAAGACGCAACGACA
TGTGAACCGTTTTCGCGATGCAATCTTGCAAAATGATCCAGCGTGTCCCGCTACCCGTGCTGCTGTACTTTCCGAACGTGTCTTCTTCAGCATGCTTCGC
TGACTGTTTCTCTCCCCACCCACAGTGTTCACTCAGCACGAAAGCATGGAAAAGCTTTGGCGTCTTCCAGCACGAGTTAAAGATTTCTGCCAGCGAGCGG
GGACAATCGCGCAAGCGGCGCAGATAACTTTCTGCAGACACAAATGATGCCTCAGCATTGTCTTCCCCCTCTTGCTCTATTGCCGTCTCCACATCTCCGA
TGACGAAGTACGGGTCTAGCCAACGCTGAAGAGATGAAGACATTGATGGAGGAGGCAGTGCGAGTACTGCACCGAGAGGGAGTGAGTAGTACCACTCAAT
AAATAGTCTTGTAAGTGTATCTTCCGACAAGAAGATAGCCGAATGTAGTTGTTGCAGCTCCTAACCAAGTCGGAAGCAAGTTAGATGTTTAGTATCAAGC
ATCGCCGGAATCCAAATGATAAGCATACCTGAACCGCGAAGACACTTGACAGCACTGGTGCGAGAATAAACGTAACGAGGCAGTCTCTATGAGCTGCAGT
CGAAAATTTGCGGAAAATCGGAGTCTTCAACACACGAAAACTTTTGCGCAAAAACTCCTCTTTCGTTTCAGCAATCTCAAACAGAGACAGAATATCTCGA
CGACGGGGTAACTCAGGATCGCTGAACGGCATCGAGAAGAACTCCATGAACTCCCACGCAGTGAGCTGGCTAGCGCTATCGATCGCTTTACGTGTTCGGG
CACAGGATTCGTCGTCCAGCGCAAGACCAGCGCGACGAAAAAGTTCCAACCACGGGAAGATTCGCGGTCCTGACTGCTTCTCTTTTGCACCGGAACGAGA
AATGATTTCTCTTGTGGAAGTCTGCATCATTGACATAAGCGCACGCTTGCCACGCTCAAACTCCTGTACGTATTAGACACCATTTAGTAAACTTGAACAA
AATACAACAGCAGAGCTGCAACACACTTACAGCTCGGAATCCAATAAATGTGGACACGAGGCGGTGTTGCCAAAGCAACTTCCACTGAAGTGATAGTTCT
GCTCCAGTCGGTGTTCTGGATGACATCCCATTCTTCAACGCCTGTAAAACGCACGAGTCAGATACTCAATGAAATTCGAAAACAAGCGTGCGTACAGTCT
TACCAGCTGTAACTTCTCCAGCGCCTTGAGCAAGAAGTTTGCATTCAGTAATGCCATATCGGCATTAAGCAAAACATCAAGCAGCGTCTGGATCGTTGTT
GATGAAGACAGACTGCCGATGTCCTCTAACAACGGGTCTAGTGCATCTTGTTCAAGCGTATGAGTCGCATCGACCCGTTTTTTCTTAACGAACGCTTGAA
GACCACCTATCACTTGGTGCAAAAGGAAGTTCTCCTCTTGAAGTTTGTTCTGCGTAAAATACTTCATCAATATCGACGCGTCCGGCAGCCCGGGCTTCAA
TTCAATCAATTCCGACACAGTGTCGCTCGTCTTAGACAGTACCACGCACTTGGTTCTCCCTGTTGCCGGGTCAAACTGTGTAAAGAGTTTAGCACTGTTG
CCCACCGCAAAACTGAACACCCTGGGCCCGTACCGAGCACGCCAAACTTCTACGATACCACGTTGGGCCGAGTAAATGACAAGATAGAGCCCAGGAGGCC
GATGGGTTCCTTCAGAGCCTTGCATCCAGCCGCACTGCGCGTTACGATAGCCCTTCCACATCCGAATCACGATCATTCGAGAAGTGTCGACAAGTAGAAT
TCGGCCAAGCGTGTCCGAAACTGCGGCCAACCTGCCTGTGGGGCTCAAAACTAGAACCCTGCAGCGCCGCCGCTCGTCTTCGTAAATCGAGCGCGTAATG
CCAACAGGGGCAGGCACATGCTCAGCAGCAGCGTCGATCGCACCAGCGCCGAGCTGTGCGTACGCCGCTGTTCATCTCCAGCTGTAAGTCCCCCTGTACC
GCGTGTCCAGCCCCAGCTCGTCGCAAAGTTCCACACAGCCCCCGCCGC